G2C::Genetics

Genotyping

Genomic DNA was isolated from ES cells by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 211bp product amplified from the wild-type (wt) allele using a forward primer A (GTGCTGTAAGAAGCAGGCTG) and reverse primer B (CTGCCACAGAGATACATCTTG). A 466bp product was amplified from the targeted allele using forward primer C (CCTCCCCCTGAACCTGAAAC) with reverse primer B. After enzymatic amplification for 35 cycles (45 seconds at 94 °C, 45 seconds at 55 °C, and 1 minute at 72 °C), the PCR products were size-fractionated on a 2% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (A,B & C). PCR genotyping of targeted CYFIP1 mice using a common reverse primer, B, and forward primers A and C to amplify the wt and mutant alleles respectively.

Expression

Total RNA was extracted from whole mouse brain using RNeasy Midi kit (Qiagen, Cat 75144). RT-PCR was performed by generating first strand cDNA and using forward primer, Y (CATGTTTGCTGTGTTGGATG), which anneals to exon 6 and reverse primer, Z (GTCAAGTACATCCTGTTCTC), which anneals to exon 8. A product of 270bp was generated from WT cDNA and a weaker product was detected from heterozygote cDNA where the exons have been replaced by the cassette.

Primers used for RT-PCR (Y & Z) RT-PCR genotyping using forward primer Y, in exon 6, and reverse primer Z, in exon 8. A product of 270bp was generated from WT cDNA and weaker product was detected from heterozygote cDNA where the exons have been replaced by the cassette.

Breeding

CYFIP1^-/- mice were known to be lethal so CYFIP1^+/- mice were produced for phenotypic analysis. Male and female CYFIP1^+/- developed normally to adulthood, were fertile, exhibited normal body size and no gross abnormalities. Genotypes of 3-week-old pups from CYFIP1^+/- back-crosses identified 38 wildtype and 23 CYFIP1^+/- progeny. Backcrosses onto the C57BL/6J background were used to maintain the colony.