G2C::Genetics

Rap1gap knock-out mouse

S.G.N. Grant and the G2C Consortium

Corresponding email: Seth.Grant@ed.ac.uk  

 

G2CMine Data Warehouse

Rap1gap @ G2CMine

Genetic and Genomic Information

Gene symbol Rap1gap
MGI ID MGI:109338
G2Cdb mouse G00000260
Ensembl mouse ENSMUSG00000041351
G2Cdb human G00001509
Ensembl human ENSG00000076864

G2CMine Data Warehouse

G2CMine integrates the scientific findings of the Genes to Cognition Programme that utilised neuroproteomics, psychiatric genetics, high-throughput mouse gene targeting combined with behavioural and electrophysiological phenotyping and informatics in order to develop a general strategy for understanding cognition at the molecular, cellular and systems neuroscience levels.

G2CMine provides comprehensive Gene Ontology, Mammalian Phenotype Ontology, Human Phenotype Ontology, UniProt, genetic and protein interactions, and regional mouse brain expression results, together with the phenotyping results of the G2C Programme.

Mutation

Enlarge this image (876 x 684)

E14TG2a mouse embryonic stem (ES) cells were targeted with a vector containing 6.9kb and 3.2kb of flanking genomic DNA. This replaced 908bp of Rap1gap genomic DNA (X137271961 to X137272599; Ensemble Build 55) with IRES-lacZ-neo cassette. Correctly targeted ES cells were identified by long range PCR using Expand Long Template PCR system (Roche Cat 11681842001). The PCR contained primer X (5’-GAGCTATTCCAGAAGTAGTGAG-3’) and primer W (5’- GTACCTTTACAGATAGCTGTG -3’) that correspond to sequence in the IRES-lacZ-neo cassette and sequence outside the 3.2kb flanking region respectively.

The correctly targeted ES cells were injected into C57BL/6 blastocysts to create chimeric mice, which were bred with 129S5 mice to generate heterozygous (+/–) Rap1gap mutant mice. Those F1 heterozygous mice had been backcrossed with 129S5 mice for 1-2 times before being used for intercrossing.

Location of Rap1gap gene trap. Rap1gap is a 25 exon gene which encodes a GoLoco Motif and RapGAP domain(top). We replaced exons 9&10 with a selection cassette in targeted mice and created a frameshift between exons 8 and 11. Primers used for targeted clone identification (W&X) are shown.

Genotyping

Enlarge this image (1274 x 334)

Genomic DNA was isolated from ES cells by Wizard SV 96 Genomic DNA purification system (Promega Cat A2371). Genotyping PCR consisted of a 312bp product amplified from the wild-type (wt) allele using a forward primer A (GTATGTGAGGATGTCAATGTG) in the wt sequence deleted by targeted mutation and a reverse primer B (CTGTACCTCATGTGCTTTAAG) downstream of the cassette. A 420bp product was amplified from the targeted allele using primer B with forward primer X, within the selection cassette. After enzymatic amplification for 35 cycles (45 seconds at 94 °C, 45 seconds at 55 °C, and 1 minute at 72 °C), the PCR products were size-fractionated on a 2% agarose gel in 1x Tris borate-EDTA buffer.

Primers used for genotyping (A,B & X). PCR genotyping of targeted Rap1gap mice using a common reverse primer, B, and forward primers A and X to amplify the wt and mutant alleles respectively.

Expression

Enlarge this image (1290 x 332)

Total RNA was extracted from whole mouse brain using RNeasy Midi kit (Qiagen, Cat 75144). RT-PCR was performed by generating first strand cDNA and using a forward primer, Y (GTATGTGAGGATGTCAATGTG), which anneals to exon 9 and a reverse primer, Z (CTCGTTGGTACTGAATAGTTC), which anneals to exon 11. A product of 147bp was generated from WT cDNA and no product detected from homozygote cDNA where the exons have been replaced by the cassette.

Primers used for RT-PCR (y & z) RT-PCR genotyping - forward primer, Y in exon 9 and reverse primer, Z in exon 11, amplification occurs in wt mice but no band in targeted mice where exon 9 has been replaced by the selection cassette.

Breeding

Birth of Rap1gap-/- mice followed Mendelian ratios with 25% of offspring being homozygous knockouts. Genotypes of 3-week-old pups from Rap1gap+/- intercrosses identified 39 wt, 76 Rap1gap+/- and 38 Rap1gap-/- progeny (Χ2 p= 0.879). Male and female Rap1gap-/- mice developed normally to adulthood, exhibited normal body size and no gross abnormalities Rap1gap mice were maintained by backcrossing onto the 129S5/SvEvBrd background; heterozygous males and females were fertile and used to set up intercrosses to generate homozygous and wildtype mice to study.

Overview

Mutant mice showed no discernible overall behavioural difference from wildtypes, with only one behaviour variable, RR memory, significantly increased by this mutation. Definitions of variables may be found below.

Enlarge this image (600 x 700)

The G2CMine data warehouse provides cohort summaries and individual mouse observations from the Rap1gap knock-out line phenotyping.

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM. OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field. RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1. Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable Units Wildtype M (n=13) Wildtype F (n=14) Mutant M (n=12) Mutant F (n=13) P(sex×mutation) P(mutation)
EPM total distance cm 883 (53) 912 (59) 847 (67) 904 (73) 0.83 0.74
EPM max speed cm/s 15.9 (0.6) 18.3 (0.8) 16.6 (0.7) 17.6 (0.9) 0.42 0.96
EPM % time in open % 44.8 (7.1) 28.4 (7) 33.7 (9.2) 42.5 (8.1) 0.12 0.8
EPM time in centre s 150 (13) 124 (10) 105 (12) 122 (18) 0.12 0.091
EPM max speed, open vs closed cm/s -1.7 (1) -4.6 (1.7) -3.3 (1.6) -1.3 (1.1) 0.086 0.49
OF, NOE total distance log10 cm 3.28 (0.08) 3.21 (0.09) 3.27 (0.07) 3.33 (0.05) 0.4 0.44
NOE vs OF distance travelled cm -250 (180) -320 (110) -440 (140) -370 (190) 0.65 0.45
RR naive fall time log10 s 1.02 (0.09) 1.05 (0.07) 0.81 (0.08) 1.13 (0.09) 0.088 0.47
RR learning s/trial 1.1 (0.4) 2.2 (0.8) 0.5 (0.3) 1.3 (0.9) 0.88 0.26
RR memory s 5.7 (2.6) 13.3 (4.8) 2.2 (2) 1.6 (3.9) 0.26 0.038 *
Fear learning, trial effect % freezing 47.4 (8) 55.2 (7.3) 42.2 (8.3) 45.7 (8.9) 0.79 0.37
Fear learning, tone effect % freezing 9.7 (5.2) 0.1 (5.1) -8.1 (5.3) 15 (6.6) 0.0051 ** 0.88
Contextual memory, mean % freezing 38.4 (4.5) 41.7 (5.1) 38.1 (6) 41.2 (5.3) 0.98 0.93
Contextual memory, change % freezing 43.1 (5.5) 38 (6.4) 32.9 (4.3) 30.3 (8.2) 0.84 0.17
Cued memory, mean % freezing -1 (4.3) -3.5 (7) -1.6 (7.1) -2.9 (5.5) 0.93 1
Cued memory, change % freezing -4.6 (6.1) 3.5 (9.1) 13.1 (6.8) 6.2 (6.5) 0.31 0.18

Elevated Plus Maze

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: EPM total distance, Total distance (cm) travelled in any arm or central zone of the EPM. EPM max speed, Maximum speed (cm/s) travelled in any arm or central zone of the EPM. EPM % time in open, Percentage of time in the open or closed arms of the EPM spent in open arms. EPM time in centre, Total time (s) spent in the central zone of the EPM. EPM max speed, open vs closed, Difference between the maximum speed (cm/s) observed in the open arms and the closed arms of the EPM.

 

Variable Units Wildtype M (n=13) Wildtype F (n=14) Mutant M (n=12) Mutant F (n=13) P(sex×mutation) P(mutation)
EPM total distance cm 883 (53) 912 (59) 847 (67) 904 (73) 0.83 0.74
EPM max speed cm/s 15.9 (0.6) 18.3 (0.8) 16.6 (0.7) 17.6 (0.9) 0.42 0.96
EPM % time in open % 44.8 (7.1) 28.4 (7) 33.7 (9.2) 42.5 (8.1) 0.12 0.8
EPM time in centre s 150 (13) 124 (10) 105 (12) 122 (18) 0.12 0.091
EPM max speed, open vs closed cm/s -1.7 (1) -4.6 (1.7) -3.3 (1.6) -1.3 (1.1) 0.086 0.49

Open Field/Novel Object

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: OF, NOE total distance, Total distance travelled (log₁₀ cm) during initial exposure to the open field and in presence of the novel object. NOE vs OF distance travelled, Difference in distance travelled (cm) in presence of the novel object and during initial exposure to open field.

 

Variable Units Wildtype M (n=13) Wildtype F (n=14) Mutant M (n=12) Mutant F (n=13) P(sex×mutation) P(mutation)
OF, NOE total distance log10 cm 3.28 (0.08) 3.21 (0.09) 3.27 (0.07) 3.33 (0.05) 0.4 0.44
NOE vs OF distance travelled cm -250 (180) -320 (110) -440 (140) -370 (190) 0.65 0.45

Rotarod

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: RR naive fall time, Fall time on accelerating rotarod (log₁₀ s), naive performance in session 1. RR learning, Learning on rotarod, measured as increase in fall time per trial (s/trial) in session 1. RR memory, Memory on rotarod, measured as excess fall time at middle of session 2 relative to middle of session 1.

 

Variable Units Wildtype M (n=13) Wildtype F (n=14) Mutant M (n=12) Mutant F (n=13) P(sex×mutation) P(mutation)
RR naive fall time log10 s 1.02 (0.09) 1.05 (0.07) 0.81 (0.08) 1.13 (0.09) 0.088 0.47
RR learning s/trial 1.1 (0.4) 2.2 (0.8) 0.5 (0.3) 1.3 (0.9) 0.88 0.26
RR memory s 5.7 (2.6) 13.3 (4.8) 2.2 (2) 1.6 (3.9) 0.26 0.038 *

Fear Conditioning

Enlarge this image (800 x 600)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

Enlarge this image (640 x 480)

 

Variables shown are: Fear learning, trial effect, Fear learning, measured as extra % time freezing before third trial compared to % time freezing before first trial. Fear learning, tone effect, Fear learning, measured as increase in % time freezing due to third tone compared to increase in % time freezing due to first tone. Contextual memory, mean, Contextual memory, measured as difference in % time freezing during first 120 s re-exposure to the box compared to first 120 s in the box on previous day. Contextual memory, change, Contextual memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the box. Cued memory, mean, Cued memory, measured as increase in % time spent freezing during 120 s of tone re-exposure compared to increase in % time spent freezing during initial tone on previous day. Cued memory, change, Cued memory, measured as increase in % time spent freezing from first time bin of 30 s to fourth bin of 30 s during 120 s re-exposure to the tone.

 

Variable Units Wildtype M (n=13) Wildtype F (n=14) Mutant M (n=12) Mutant F (n=13) P(sex×mutation) P(mutation)
Fear learning, trial effect % freezing 47.4 (8) 55.2 (7.3) 42.2 (8.3) 45.7 (8.9) 0.79 0.37
Fear learning, tone effect % freezing 9.7 (5.2) 0.1 (5.1) -8.1 (5.3) 15 (6.6) 0.0051 ** 0.88
Contextual memory, mean % freezing 38.4 (4.5) 41.7 (5.1) 38.1 (6) 41.2 (5.3) 0.98 0.93
Contextual memory, change % freezing 43.1 (5.5) 38 (6.4) 32.9 (4.3) 30.3 (8.2) 0.84 0.17
Cued memory, mean % freezing -1 (4.3) -3.5 (7) -1.6 (7.1) -2.9 (5.5) 0.93 1
Cued memory, change % freezing -4.6 (6.1) 3.5 (9.1) 13.1 (6.8) 6.2 (6.5) 0.31 0.18
© G2C 2014. The Genes to Cognition Programme received funding from The Wellcome Trust and the EU FP7 Framework Programmes:
EUROSPIN (FP7-HEALTH-241498), SynSys (FP7-HEALTH-242167) and GENCODYS (FP7-HEALTH-241995).

Cookies Policy | Terms and Conditions. This site is hosted by Edinburgh University and the Genes to Cognition Programme.