G2Cdb::Gene report

Gene id
G00001760
Gene symbol
PABPC1 (HGNC)
Species
Homo sapiens
Description
poly(A) binding protein, cytoplasmic 1
Orthologue
G00000511 (Mus musculus)

Databases (8)

Curated Gene
OTTHUMG00000139859 (Vega human gene)
Gene
ENSG00000070756 (Ensembl human gene)
26986 (Entrez Gene)
903 (G2Cdb plasticity & disease)
PABPC1 (GeneCards)
Literature
604679 (OMIM)
Marker Symbol
HGNC:8554 (HGNC)
Protein Sequence
P11940 (UniProt)

Synonyms (2)

  • PABP1
  • PABPL1

Literature (76)

Pubmed - other

  • Structural insights into the human GW182-PABC interaction in microRNA-mediated deadenylation.

    Jinek M, Fabian MR, Coyle SM, Sonenberg N and Doudna JA

    Department of Molecular and Cell Biology, University of California, Berkeley, California, USA.

    GW182-family proteins are essential for microRNA-mediated translational repression and deadenylation in animal cells. Here we show that a conserved motif in the human GW182 paralog TNRC6C interacts with the C-terminal domain of polyadenylate binding protein 1 (PABC) and present the crystal structure of the complex. Mutations at the complex interface impair mRNA deadenylation in mammalian cell extracts, suggesting that the GW182-PABC interaction contributes to microRNA-mediated gene silencing.

    Funded by: Canadian Institutes of Health Research; Howard Hughes Medical Institute; NIGMS NIH HHS: R01 GM073794, R01 GM073794-05

    Nature structural & molecular biology 2010;17;2;238-40

  • Poly(A)-binding protein modulates mRNA susceptibility to cap-dependent miRNA-mediated repression.

    Walters RW, Bradrick SS and Gromeier M

    Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710, USA.

    MicroRNAs (miRNAs) regulate gene expression post-transcriptionally through binding specific sites within the 3' untranslated regions (UTRs) of their target mRNAs. Numerous investigations have documented repressive effects of miRNAs and identified factors required for their activity. However, the precise mechanisms by which miRNAs modulate gene expression are still obscure. Here, we have examined the effects of multiple miRNAs on diverse target transcripts containing artificial or naturally occurring 3' UTRs in human cell culture. In agreement with previous studies, we report that both the 5' m(7)G cap and 3' poly(A) tail are essential for maximum miRNA repression. These cis-acting elements also conferred miRNA susceptibility to target mRNAs translating under the control of viral- and eukaryotic mRNA-derived 5' UTR structures that enable cap-independent translation. Additionally, we evaluated a role for the poly(A)-binding protein (PABP) in miRNA function utilizing multiple approaches to modulate levels of active PABP in cells. PABP expression and activity inversely correlated with the strength of miRNA silencing, in part due to antagonism of target mRNA deadenylation. Together, these findings further define the cis- and trans-acting factors that modulate miRNA efficacy.

    Funded by: NCI NIH HHS: CA124756, R01 CA124756; NIDDK NIH HHS: K01 DK082613

    RNA (New York, N.Y.) 2010;16;1;239-50

  • Genomewide association study of a rapid progression cohort identifies new susceptibility alleles for AIDS (ANRS Genomewide Association Study 03).

    Le Clerc S, Limou S, Coulonges C, Carpentier W, Dina C, Taing L, Delaneau O, Labib T, Sladek R, ANRS Genomic Group, Deveau C, Guillemain H, Ratsimandresy R, Montes M, Spadoni JL, Therwath A, Schächter F, Matsuda F, Gut I, Lelièvre JD, Lévy Y, Froguel P, Delfraissy JF, Hercberg S and Zagury JF

    Conservatoire National des Arts et Métiers, Paris, France.

    Background: Previous genomewide association studies (GWASs) of AIDS have targeted end points based on the control of viral load and disease nonprogression. The discovery of genetic factors that predispose individuals to rapid progression to AIDS should also reveal new insights into the molecular etiology of the pathology.

    Methods: We undertook a case-control GWAS of a unique cohort of 85 human immunodeficiency virus type 1 (HIV-1)-infected patients who experienced rapid disease progression, using Illumina HumanHap300 BeadChips. The case group was compared with a control group of 1352 individuals for the 291,119 autosomal single-nucleotide polymorphisms (SNPs) passing the quality control tests, using the false-discovery rate (FDR) statistical method for multitest correction.

    Results: Novel associations with rapid progression (FDR, < or = 25%) were identified for PRMT6 (P = 6.1 x 10(-7); odds ratio [OR], 0.24), SOX5 (P = 1.8 x 10(-6); OR, 0.45), RXRG (P = 3.9 x 10(-6); OR, 3.29), and TGFBRAP1 (P = 7 x 10(-6); OR, 0.34). The haplotype analysis identified exonic and promoter SNPs potentially important for PRMT6 and TGFBRAP1 function.

    Conclusions: The statistical and biological relevance of these associations and their high ORs underscore the power of extreme phenotypes for GWASs, even with a modest sample size. These genetic results emphasize the role of the transforming growth factor beta pathway in the pathogenesis of HIV-1 disease. Finally, the wealth of information provided by this study should help unravel new diagnostic and therapeutic targets.

    The Journal of infectious diseases 2009;200;8;1194-201

  • Uncoupling stress granule assembly and translation initiation inhibition.

    Mokas S, Mills JR, Garreau C, Fournier MJ, Robert F, Arya P, Kaufman RJ, Pelletier J and Mazroui R

    Département de Biologie Médicale, Centre Hospitalier Universitaire de Québec/Centre De Recherche Hôpital Saint-François D'assise, Université Laval, Quebec, QC, Canada.

    Cytoplasmic stress granules (SGs) are specialized regulatory sites of mRNA translation that form under different stress conditions known to inhibit translation initiation. The formation of SG occurs via two pathways; the eukaryotic initiation factor (eIF) 2alpha phosphorylation-dependent pathway mediated by stress and the eIF2alpha phosphorylation-independent pathway mediated by inactivation of the translation initiation factors eIF4A and eIF4G. In this study, we investigated the effects of targeting different translation initiation factors and steps in SG formation in HeLa cells. By depleting eIF2alpha, we demonstrate that reduced levels of the eIF2.GTP.Met-tRNAi(Met) ternary translation initiation complexes is sufficient to induce SGs. Likewise, reduced levels of eIF4B, eIF4H, or polyA-binding protein, also trigger SG formation. In contrast, depletion of the cap-binding protein eIF4E or preventing its assembly into eIF4F results in modest SG formation. Intriguingly, interfering with the last step of translation initiation by blocking the recruitment of 60S ribosome either with 2-(4-methyl-2,6-dinitroanilino)-N-methylpropionamideis or through depletion of the large ribosomal subunits protein L28 does not induce SG assembly. Our study identifies translation initiation steps and factors involved in SG formation as well as those that can be targeted without induction of SGs.

    Funded by: NHLBI NIH HHS: P01 HL057346, P01 HL057346-100006, P01 HL057346-11A18575, R01 HL052173, R01 HL052173-11, R01 HL052173-12; NIDDK NIH HHS: R37 DK042394, R37 DK042394-10, R37 DK042394-11

    Molecular biology of the cell 2009;20;11;2673-83

  • Bunyamwera orthobunyavirus S-segment untranslated regions mediate poly(A) tail-independent translation.

    Blakqori G, van Knippenberg I and Elliott RM

    Centre for Biomolecular Sciences, School of Biology, University of St. Andrews, North Haugh, St. Andrews KY16 9ST, Scotland, United Kingdom.

    The mRNAs of Bunyamwera virus (BUNV), the prototype of the Bunyaviridae family, possess a 5' cap structure but lack a 3' poly(A) tail, a common feature of eukaryotic mRNAs that greatly enhances translation efficiency. Viral mRNAs also contain untranslated regions (UTRs) that flank the coding sequence. Using model virus-like mRNAs that harbor the Renilla luciferase reporter gene, we found that the 3' UTR of the BUNV small-segment mRNA mediated efficient translation in the absence of a poly(A) tail. Viral UTRs did not increase RNA stability, and polyadenylation did not significantly enhance reporter activity. Translation of virus-like mRNAs in transfected cells was unaffected by knockdown of poly(A)-binding protein (PABP) but was markedly reduced by depletion of eukaryotic initiation factor 4G, suggesting a PABP-independent process for translation initiation. In BUNV-infected cells, translation of polyadenylated but not virus-like mRNAs was inhibited. Furthermore, we demonstrate that the viral nucleocapsid protein binds to, and colocalizes with, PABP in the cytoplasm early in infection, followed by nuclear retention of PABP. Our results suggest that BUNV corrupts PABP function in order to inhibit translation of polyadenylated cellular mRNAs while its own mRNAs are translated in a PABP-independent process.

    Funded by: Wellcome Trust

    Journal of virology 2009;83;8;3637-46

  • Nuclear localization of cytoplasmic poly(A)-binding protein upon rotavirus infection involves the interaction of NSP3 with eIF4G and RoXaN.

    Harb M, Becker MM, Vitour D, Baron CH, Vende P, Brown SC, Bolte S, Arold ST and Poncet D

    Virologie Moléculaire et Structurale INRA UMR 1157, CNRS UMR 2472, IFR 115, Avenue de la Terrasse, 91198 Gif sur Yvette, France.

    Rotavirus nonstructural protein NSP3 interacts specifically with the 3' end of viral mRNAs, with the eukaryotic translation initiation factor eIF4G, and with RoXaN, a cellular protein of yet-unknown function. By evicting cytoplasmic poly(A) binding protein (PABP-C1) from translation initiation complexes, NSP3 shuts off the translation of cellular polyadenylated mRNAs. We show here that PABP-C1 evicted from eIF4G by NSP3 accumulates in the nucleus of rotavirus-infected cells. Through modeling of the NSP3-RoXaN complex, we have identified mutations in NSP3 predicted to interrupt its interaction with RoXaN without disturbing the NSP3 interaction with eIF4G. Using these NSP3 mutants and a deletion mutant unable to associate with eIF4G, we show that the nuclear localization of PABP-C1 not only is dependent on the capacity of NSP3 to interact with eIF4G but also requires the interaction of NSP3 with a specific region in RoXaN, the leucine- and aspartic acid-rich (LD) domain. Furthermore, we show that the RoXaN LD domain functions as a nuclear export signal and that RoXaN tethers PABP-C1 with RNA. This work identifies RoXaN as a cellular partner of NSP3 involved in the nucleocytoplasmic localization of PABP-C1.

    Journal of virology 2008;82;22;11283-93

  • Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA.

    Marsh K, Soros V and Cochrane A

    Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Canada. kim.marsh@utoronto.ca

    HIV-1 structural proteins are translated from incompletely spliced 9 kb and 4 kb mRNAs, which are transported to the cytoplasm by Crm1. It has been assumed that once in the cytoplasm, translation of incompletely spliced HIV-1 mRNAs occurs in the same manner as host mRNAs. Previous analyses have demonstrated that Sam68 and a mutant thereof, Sam68DeltaC, have dramatic effects on HIV gene expression, strongly enhancing and inhibiting viral structural protein synthesis, respectively. While investigating the inhibition of incompletely spliced HIV-1 mRNAs by Sam68DeltaC, we determined that the effect was independent of the perinuclear bundling of the viral RNA. Inhibition was dependent upon the nuclear export pathway used, as translation of viral RNA exported via the Tap/CTE export pathway was not blocked by Sam68DeltaC. We demonstrate that inhibition of HIV expression by Sam68DeltaC is correlated with a loss of PABP1 binding with no attendant change in polyadenosine tail length of the affected RNAs. The capacity of Sam68DeltaC to selectively inhibit translation of HIV-1 RNAs exported by Crm1 suggests that it is able to recognize unique characteristics of these viral RNPs, a property that could lead to new therapeutic approaches to controlling HIV-1 replication.

    Retrovirology 2008;5;97

  • Cleavage of poly(A)-binding protein by poliovirus 3C proteinase inhibits viral internal ribosome entry site-mediated translation.

    Bonderoff JM, Larey JL and Lloyd RE

    Department of Molecular Virology and Microbiology, 860E, One Baylor Plaza, Houston, TX 77030, USA.

    The two enteroviral proteinases, 2A proteinase (2A(pro)) and 3C proteinase (3C(pro)), induce host cell translation shutoff in enterovirus-infected cells by cleaving canonical translation initiation factors. Cleavage of poly(A)-binding protein (PABP) by 3C(pro) has been shown to be a necessary component for host translation shutoff. Here we show that 3C(pro) inhibits cap-independent translation mediated by the poliovirus internal ribosome entry site (IRES) in a dose-dependent manner in HeLa translation extracts displaying cap-poly(A) synergy. This effect is independent of the stimulatory effect of 2A(pro) on IRES translation, and 3C(pro)-induced translation inhibition can be partially rescued by addition of recombinant PABP in vitro. 3C(pro) inhibits IRES translation on transcripts containing or lacking poly(A) tails, suggesting that cleavage of PABP and IRES trans-activating factors polypyrimidine tract-binding protein and poly r(C)-binding protein 2 may also be important for inhibition. Expression of 3C(pro) cleavage-resistant PABP in cells increased translation of nonreplicating viral minigenome reporter RNAs during infection and also delayed and reduced virus protein synthesis from replicating RNA. Further, expression of cleavage-resistant PABP in cells reduced the accumulation of viral RNA and the output of infectious virus. These results suggest that cleavage of PABP contributes to viral translation shutoff that is required for the switch from translation to RNA replication.

    Funded by: NIAID NIH HHS: AI50237, R01 AI050237, R56 AI050237; NIGMS NIH HHS: GM59803, R01 GM059803

    Journal of virology 2008;82;19;9389-99

  • Immunohistochemical identification of messenger RNA-related proteins in basophilic inclusions of adult-onset atypical motor neuron disease.

    Fujita K, Ito H, Nakano S, Kinoshita Y, Wate R and Kusaka H

    Department of Neurology, Kansai Medical University, 10-15, Fumizono-cho, Moriguchi, Osaka 570-8507, Japan.

    This report concerns an immunohistochemical investigation on RNA-related proteins in the basophilic inclusions (BIs) from patients with adult-onset atypical motor neuron disease. Formalin-fixed, paraffin-embedded sections of the motor cortex and the lumbar spinal cord were examined. The BIs appeared blue in color with H&E and Nissl stain, and pink with methylgreen-pyronin stain. Ribonuclease pretreatment abolished the methylgreen-pyronin staining, suggesting that the BIs contained RNA. Immunohistochemically, the BIs were distinctly labeled with the antibodies against poly(A)-binding protein 1, T cell intracellular antigen 1, and ribosomal protein S6. These proteins are essential constituents of stress granules. In contrast, the BIs were not immunoreactive for ribosomal protein L28 and decapping enzyme 1, which are core components of transport ribonucleoprotein particles and processing bodies, respectively. Moreover, the BIs were not immunopositive for TDP-43. Our results imply that translation attenuation could be involved in the processes of BI formation in this disorder.

    Acta neuropathologica 2008;116;4;439-45

  • Inhibition of tristetraprolin deadenylation by poly(A) binding protein.

    Rowlett RM, Chrestensen CA, Schroeder MJ, Harp MG, Pelo JW, Shabanowitz J, DeRose R, Hunt DF, Sturgill TW and Worthington MT

    Department of Medicine, University of Virginia, Charlottesville, VA, USA.

    Tristetraprolin (TTP) is the prototype for a family of RNA binding proteins that bind the tumor necrosis factor (TNF) messenger RNA AU-rich element (ARE), causing deadenylation of the TNF poly(A) tail, RNA decay, and silencing of TNF protein production. Using mass spectrometry sequencing we identified poly(A) binding proteins-1 and -4 (PABP1 and PABP4) in high abundance and good protein coverage from TTP immunoprecipitates. PABP1 significantly enhanced TNF ARE binding by RNA EMSA and prevented TTP-initiated deadenylation in an in vitro macrophage assay of TNF poly(A) stability. Neomycin inhibited TTP-promoted deadenylation at concentrations shown to inhibit the deadenylases poly(A) ribonuclease and CCR4. Stably transfected RAW264.7 macrophages overexpressing PABP1 do not oversecrete TNF; instead they upregulate TTP protein without increasing TNF protein production. The PABP1 inhibition of deadenylation initiated by TTP does not require the poly(A) binding regions in RRM1 and RRM2, suggesting a more complicated interaction than simple masking of the poly(A) tail from a 3'-exonuclease. Like TTP, PABP1 is a substrate for p38 MAP kinase. Finally, PABP1 stabilizes cotransfected TTP in 293T cells and prevents the decrease in TTP levels seen with p38 MAP kinase inhibition. These findings suggest several levels of functional antagonism between TTP and PABP1 that have implications for regulation of unstable mRNAs like TNF.

    Funded by: NIDDK NIH HHS: DK-060720; NIGMS NIH HHS: GM-62890

    American journal of physiology. Gastrointestinal and liver physiology 2008;295;3;G421-30

  • Modulation of enteroviral proteinase cleavage of poly(A)-binding protein (PABP) by conformation and PABP-associated factors.

    Rivera CI and Lloyd RE

    Department of Molecular Virology and Microbiology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.

    Poliovirus (PV) causes a drastic inhibition of cellular cap-dependant protein synthesis due to the cleavage of translation factors eukaryotic initiation factor 4G (eIF4G) and poly(A) binding protein (PABP). Only about half of cellular PABP is cleaved by viral 2A and 3C proteinases during infection. We have investigated PABP cleavage determinants that regulate this partial cleavage. PABP cleavage kinetics analyses indicate that PABP exists in multiple conformations, some of which are resistant to 3C(pro) or 2A(pro) cleavage and can be modulated by reducing potential. Cleavage reactions containing a panel of PABP-binding proteins revealed that eukaryotic release factor 3 (eRF3) and PABP-interacting protein 2 (Paip2) modulate and interfere with the cleavage susceptibility of PABP, whereas all other PABP-binding proteins tested do not. We show that PABP on cellular polysomes is cleaved only by 3C(pro) and that Paip2 does not sediment with polysomes. Also, viral polysomes contained only full-length PABP, however, cellular or viral ribosomes were equally susceptible to 3C(pro) cleavage in vitro. Finally, we determined that precursor 3CD and mature 3C(pro) have equivalent cleavage activity on purified PABP, but only 3C(pro) cleavage activity was stimulated by PABP-binding viral RNA. The results further elucidate complex mechanisms where multiple inherent PABP conformations and protein and RNA interactions both serve to differentially regulate PABP cleavage by 3CD, 3C(pro) and 2A(pro).

    Funded by: NIAID NIH HHS: AI50237, R01 AI050237, R01 AI050237-06A1, R56 AI050237, R56 AI050237-06; NIGMS NIH HHS: GM59803, R01 GM059803, R01 GM059803-08

    Virology 2008;375;1;59-72

  • Rubella virus capsid protein interacts with poly(a)-binding protein and inhibits translation.

    Ilkow CS, Mancinelli V, Beatch MD and Hobman TC

    Department of Cell Biology, University of Alberta, 5-14 Medical Sciences Building, Edmonton, Alberta T6G 2H7, Canada.

    During virus assembly, the capsid proteins of RNA viruses bind to genomic RNA to form nucleocapsids. However, it is now evident that capsid proteins have additional functions that are unrelated to nucleocapsid formation. Specifically, their interactions with cellular proteins may influence signaling pathways or other events that affect virus replication. Here we report that the rubella virus (RV) capsid protein binds to poly(A)-binding protein (PABP), a host cell protein that enhances translational efficiency by circularizing mRNAs. Infection of cells with RV resulted in marked increases in the levels of PABP, much of which colocalized with capsid in the cytoplasm. Mapping studies revealed that capsid binds to the C-terminal half of PABP, which interestingly is the region that interacts with other translation regulators, including PABP-interacting protein 1 (Paip1) and Paip2. The addition of capsid to in vitro translation reaction mixtures inhibited protein synthesis in a dose-dependent manner; however, the capsid block was alleviated by excess PABP, indicating that inhibition of translation occurs through a stoichiometric mechanism. To our knowledge, this is the first report of a viral protein that inhibits protein translation by sequestration of PABP. We hypothesize that capsid-dependent inhibition of translation may facilitate the switch from viral translation to packaging RNA into nucleocapsids.

    Journal of virology 2008;82;9;4284-94

  • Proximity of the poly(A)-binding protein to a premature termination codon inhibits mammalian nonsense-mediated mRNA decay.

    Silva AL, Ribeiro P, Inácio A, Liebhaber SA and Romão L

    Centro de Genética Humana, Instituto Nacional de Saúde Dr. Ricardo Jorge, 1649-016 Lisboa, Portugal.

    mRNA surveillance pathways selectively clear defective mRNAs from the cell. As such, these pathways serve as important modifiers of genetic disorders. Nonsense-mediated decay (NMD), the most intensively studied surveillance pathway, recognizes mRNAs with premature termination codons (PTCs). In mammalian systems the location of a PTC more than 50 nucleotides 5' to the terminal exon-exon junction is a critical determinant of NMD. However, mRNAs with nonsense codons that fulfill this requirement but are located very early in the open reading frame can effectively evade NMD. The unexpected resistance of such mRNAs with AUG-proximal PTCs to accelerated decay suggests that important determinants of NMD remain to be identified. Here, we report that an NMD-sensitive mRNA can be stabilized by artificially tethering the cytoplasmic poly(A) binding protein 1, PABPC1, at a PTC-proximal position. Remarkably, the data further suggest that NMD of an mRNA with an AUG-proximal PTC can also be repressed by PABPC1, which might be brought into proximity with the PTC during cap-dependent translation and 43S scanning. These results reveal a novel parameter of NMD in mammalian cells that can account for the stability of mRNAs with AUG-proximal PTCs. These findings serve to expand current mechanistic models of NMD and mRNA translation.

    Funded by: NCI NIH HHS: P01 CA072765, P01 CA72765; NHLBI NIH HHS: R37 HL065449, R37-HL65449

    RNA (New York, N.Y.) 2008;14;3;563-76

  • Mechanism of mRNA deadenylation: evidence for a molecular interplay between translation termination factor eRF3 and mRNA deadenylases.

    Funakoshi Y, Doi Y, Hosoda N, Uchida N, Osawa M, Shimada I, Tsujimoto M, Suzuki T, Katada T and Hoshino S

    Department of Biological Chemistry, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya 467-8603, Japan.

    In eukaryotes, shortening of the 3'-poly(A) tail is the rate-limiting step in the degradation of most mRNAs, and two major mRNA deadenylase complexes--Caf1-Ccr4 and Pan2-Pan3--play central roles in this process, referred to as deadenylation. However, the molecular mechanism triggering deadenylation remains elusive. Previously, we demonstrated that eukaryotic releasing factor eRF3 mediates deadenylation and decay of mRNA in a manner coupled to translation termination. Here, we report the mechanism of mRNA deadenylation. The eRF3-mediated deadenylation is catalyzed by both Caf1-Ccr4 and Pan2-Pan3. Interestingly, translation termination complexes eRF1-eRF3, Pan2-Pan3, and Caf1-Ccr4 competitively interact with polyadenylate-binding protein PABPC1. In each complex, eRF3, Pan3, and Tob, respectively, mediate PABPC1 binding, and a combination of a PAM2 motif and a PABC domain is commonly utilized for their contacts. A translation-dependent exchange of eRF1-eRF3 for the deadenylase occurs on PABPC1. Consequently, PABPC1 binding leads to the activation of Pan2-Pan3 and Caf1-Ccr4. From these results, we suggest a mechanism of mRNA deadenylation by Pan2-Pan3 and Caf1-Ccr4 in cooperation with eRF3 and PABPC1.

    Genes & development 2007;21;23;3135-48

  • Human TOB, an antiproliferative transcription factor, is a poly(A)-binding protein-dependent positive regulator of cytoplasmic mRNA deadenylation.

    Ezzeddine N, Chang TC, Zhu W, Yamashita A, Chen CY, Zhong Z, Yamashita Y, Zheng D and Shyu AB

    Department of Biochemistry and Molecular Biology, The University of Texas Medical School, Houston, Texas 77030, USA.

    In mammalian cells, mRNA decay begins with deadenylation, which involves two consecutive phases mediated by the PAN2-PAN3 and the CCR4-CAF1 complexes, respectively. The regulation of the critical deadenylation step and its relationship with RNA-processing bodies (P-bodies), which are thought to be a site where poly(A)-shortened mRNAs get degraded, are poorly understood. Using the Tet-Off transcriptional pulsing approach to investigate mRNA decay in mouse NIH 3T3 fibroblasts, we found that TOB, an antiproliferative transcription factor, enhances mRNA deadenylation in vivo. Results from glutathione S-transferase pull-down and coimmunoprecipitation experiments indicate that TOB can simultaneously interact with the poly(A) nuclease complex CCR4-CAF1 and the cytoplasmic poly(A)-binding protein, PABPC1. Combining these findings with those from mutagenesis studies, we further identified the protein motifs on TOB and PABPC1 that are necessary for their interaction and found that interaction with PABPC1 is necessary for TOB's deadenylation-enhancing effect. Moreover, our immunofluorescence microscopy results revealed that TOB colocalizes with P-bodies, suggesting a role of TOB in linking deadenylation to the P-bodies. Our findings reveal a new mechanism by which the fate of mammalian mRNA is modulated at the deadenylation step by a protein that recruits poly(A) nuclease(s) to the 3' poly(A) tail-PABP complex.

    Funded by: NIGMS NIH HHS: GM 46454, R01 GM046454

    Molecular and cellular biology 2007;27;22;7791-801

  • Poly(A) nuclease interacts with the C-terminal domain of polyadenylate-binding protein domain from poly(A)-binding protein.

    Siddiqui N, Mangus DA, Chang TC, Palermino JM, Shyu AB and Gehring K

    Department of Biochemistry, McGill University, Montréal, Quebec H3G 1Y6, Canada.

    The poly(A)-binding protein (PABP) is an essential protein found in all eukaryotes and is involved in an extensive range of cellular functions, including translation, mRNA metabolism, and mRNA export. Its C-terminal region contains a peptide-interacting PABC domain that recruits proteins containing a highly specific PAM-2 sequence motif to the messenger ribonucleoprotein complex. In humans, these proteins, including Paip1, Paip2, eRF3 (eukaryotic release factor 3), Ataxin-2, and Tob2, are all found to regulate translation through varying mechanisms. The following reports poly(A) nuclease (PAN) as a PABC-interacting partner in both yeast and humans. Their interaction is mediated by a PAM-2 motif identified within the PAN3 subunit. This site was identified in various fungal and animal species suggesting that the interaction is conserved throughout evolution. Our results indicate that PABP is directly involved in recruiting a deadenylase to the messenger ribonucleoprotein complex. This demonstrates a novel role for the PABC domain in mRNA metabolic processes and gives further insight into the function of PABP in mRNA maturation, export, and turnover.

    Funded by: NIGMS NIH HHS: GM46454

    The Journal of biological chemistry 2007;282;34;25067-75

  • Systematic analysis of the protein interaction network for the human transcription machinery reveals the identity of the 7SK capping enzyme.

    Jeronimo C, Forget D, Bouchard A, Li Q, Chua G, Poitras C, Thérien C, Bergeron D, Bourassa S, Greenblatt J, Chabot B, Poirier GG, Hughes TR, Blanchette M, Price DH and Coulombe B

    Laboratory of Gene Transcription and Proteomics Discovery Platform, Institut de Recherches Cliniques de Montréal, Montréal, QC, Canada.

    We have performed a survey of soluble human protein complexes containing components of the transcription and RNA processing machineries using protein affinity purification coupled to mass spectrometry. Thirty-two tagged polypeptides yielded a network of 805 high-confidence interactions. Remarkably, the network is significantly enriched in proteins that regulate the formation of protein complexes, including a number of previously uncharacterized proteins for which we have inferred functions. The RNA polymerase II (RNAP II)-associated proteins (RPAPs) are physically and functionally associated with RNAP II, forming an interface between the enzyme and chaperone/scaffolding proteins. BCDIN3 is the 7SK snRNA methylphosphate capping enzyme (MePCE) present in an snRNP complex containing both RNA processing and transcription factors, including the elongation factor P-TEFb. Our results define a high-density protein interaction network for the mammalian transcription machinery and uncover multiple regulatory factors that target the transcription machinery.

    Funded by: Canadian Institutes of Health Research: 14309-3, 82851-1

    Molecular cell 2007;27;2;262-74

  • Molecular composition of IMP1 ribonucleoprotein granules.

    Jønson L, Vikesaa J, Krogh A, Nielsen LK, Hansen Tv, Borup R, Johnsen AH, Christiansen J and Nielsen FC

    Department of Clinical Biochemistry, Rigshospitalet, University of Copenhagen, Denmark.

    Localized mRNAs are transported to sites of local protein synthesis in large ribonucleoprotein (RNP) granules, but their molecular composition is incompletely understood. Insulin-like growth factor II mRNA-binding protein (IMP) zip code-binding proteins participate in mRNA localization, and in motile cells IMP-containing granules are dispersed around the nucleus and in cellular protrusions. We isolated the IMP1-containing RNP granules and found that they represent a unique RNP entity distinct from neuronal hStaufen and/or fragile X mental retardation protein granules, processing bodies, and stress granules. Granules were 100-300 nm in diameter and consisted of IMPs, 40 S ribosomal subunits, shuttling heterologous nuclear RNPs, poly(A)-binding proteins, and mRNAs. Moreover granules contained CBP80 and factors belonging to the exon junction complex and lacked eIF4E, eIF4G, and 60 S ribosomal subunits, indicating that embodied mRNAs are not translated. Granules embodied mRNAs corresponding to about 3% of the human embryonic kidney 293 mRNA transcriptome. Messenger RNAs encoding proteins participating in the secretory pathway and endoplasmic reticulum-associated quality control, as well as ubiquitin-dependent metabolism, were enriched in the granules, reinforcing the concept of RNP granules as post-transcriptional operons.

    Molecular & cellular proteomics : MCP 2007;6;5;798-811

  • Proteomics analysis of the interactome of N-myc downstream regulated gene 1 and its interactions with the androgen response program in prostate cancer cells.

    Tu LC, Yan X, Hood L and Lin B

    Institute for Systems Biology, Seattle, Washington 98103, USA.

    NDRG1 is known to play important roles in both androgen-induced cell differentiation and inhibition of prostate cancer metastasis. However, the proteins associated with NDRG1 function are not fully enumerated. Using coimmunoprecipitation and mass spectrometry analysis, we identified 58 proteins that interact with NDRG1 in prostate cancer cells. These proteins include nuclear proteins, adhesion molecules, endoplasmic reticulum (ER) chaperons, proteasome subunits, and signaling proteins. Integration of our data with protein-protein interaction data from the Human Proteome Reference Database allowed us to build a comprehensive interactome map of NDRG1. This interactome map consists of several modules such as a nuclear module and a cell membrane module; these modules explain the reported versatile functions of NDRG1. We also determined that serine 330 and threonine 366 of NDRG1 were phosphorylated and demonstrated that the phosphorylation of NDRG1 was prominently mediated by protein kinase A (PKA). Further, we showed that NDRG1 directly binds to beta-catenin and E-cadherin. However, the phosphorylation of NDRG1 did not interrupt the binding of NDRG1 to E-cadherin and beta-catenin. Finally, we showed that the inhibition of NDRG1 expression by RNA interference decreased the ER inducible chaperon GRP94 expression, directly proving that NDRG1 is involved in the ER stress response. Intriguingly, we observed that many members of the NDRG1 interactome are androgen-regulated and that the NDRG1 interactome links to the androgen response network through common interactions with beta-catenin and heat shock protein 90. Therefore we overlaid the transcriptomic expression changes in the NDRG1 interactome in response to androgen treatment and built a dual dynamic picture of the NDRG1 interactome in response to androgen. This interactome map provides the first road map for understanding the functions of NDRG1 in cells and its roles in human diseases, such as prostate cancer, which can progress from androgen-dependent curable stages to androgen-independent incurable stages.

    Funded by: NCI NIH HHS: 1U54CA119347, 5P01CA085859, 5P50CA097186; NIDA NIH HHS: 1U54DA021519; NIGMS NIH HHS: 1P50GM076547, P50 GM076547

    Molecular & cellular proteomics : MCP 2007;6;4;575-88

  • Large-scale mapping of human protein-protein interactions by mass spectrometry.

    Ewing RM, Chu P, Elisma F, Li H, Taylor P, Climie S, McBroom-Cerajewski L, Robinson MD, O'Connor L, Li M, Taylor R, Dharsee M, Ho Y, Heilbut A, Moore L, Zhang S, Ornatsky O, Bukhman YV, Ethier M, Sheng Y, Vasilescu J, Abu-Farha M, Lambert JP, Duewel HS, Stewart II, Kuehl B, Hogue K, Colwill K, Gladwish K, Muskat B, Kinach R, Adams SL, Moran MF, Morin GB, Topaloglou T and Figeys D

    Protana, Toronto, Ontario, Canada.

    Mapping protein-protein interactions is an invaluable tool for understanding protein function. Here, we report the first large-scale study of protein-protein interactions in human cells using a mass spectrometry-based approach. The study maps protein interactions for 338 bait proteins that were selected based on known or suspected disease and functional associations. Large-scale immunoprecipitation of Flag-tagged versions of these proteins followed by LC-ESI-MS/MS analysis resulted in the identification of 24,540 potential protein interactions. False positives and redundant hits were filtered out using empirical criteria and a calculated interaction confidence score, producing a data set of 6463 interactions between 2235 distinct proteins. This data set was further cross-validated using previously published and predicted human protein interactions. In-depth mining of the data set shows that it represents a valuable source of novel protein-protein interactions with relevance to human diseases. In addition, via our preliminary analysis, we report many novel protein interactions and pathway associations.

    Molecular systems biology 2007;3;89

  • IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain.

    Patel GP and Bag J

    Department of Molecular and Cellular Biology, University of Guelph, Ontario, Canada.

    Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

    The FEBS journal 2006;273;24;5678-90

  • BRCA1 interacts with poly(A)-binding protein: implication of BRCA1 in translation regulation.

    Dizin E, Gressier C, Magnard C, Ray H, Décimo D, Ohlmann T and Dalla Venezia N

    CNRS UMR 5201, Laboratoire de Génétique Moléculaire, Signalisation et Cancer, Université Claude Bernard Lyon I, Facultéde Médecine Rockefeller, 8 Avenue Rockefeller, 69373 Lyon cedex 08, France.

    BRCA1 has been implicated in a number of cellular processes, including transcription regulation, DNA damage repair, cell cycle control, and apoptosis. We identified poly(A)-binding protein 1 (PABP) as a novel BRCA1-interacting protein in a yeast two-hybrid screen and confirmed the interaction by in vitro assays and coimmunoprecipitation in mammalian cells. Endogenous interaction between BRCA1 and PABP was also observed. This interaction was abolished by BRCA1 cancer-associated mutations, suggesting that it may be physiologically relevant. Deletion mapping demonstrated that the RNA recognition motifs 1-4 region of PABP is required to mediate the interaction with BRCA1. To understand the biological function of the BRCA1-PABP complex, we sought to determine whether BRCA1 is a modulator of translation. We showed here that inhibition of endogenous BRCA1 using a small interfering RNA-based approach decreased protein synthesis. Conversely, overexpression of BRCA1 activated translation. Using a RNA transfection approach, we clearly showed that BRCA1 modulates translation, independently of any transcriptional activity. The data presented here suggest that BRCA1 modulates protein synthesis via its interaction with PABP, providing a novel mechanism by which BRCA1 may exert its tumor suppressor function.

    The Journal of biological chemistry 2006;281;34;24236-46

  • Expression of Kaposi's sarcoma-associated herpesvirus-encoded K10/10.1 protein in tissues and its interaction with poly(A)-binding protein.

    Kanno T, Sato Y, Sata T and Katano H

    Department of Pathology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan.

    The K10/10.1 protein is encoded by a cluster of interferon regulatory factor (IRF) homologues in the Kaposi's sarcoma-associated herpesvirus (KSHV, human herpesvirus 8, HHV-8) genome. In the present study, we showed that an anti-K10 antibody reacted with a 110-kDa protein encoded by the K10/10.1 gene of KSHV in KSHV-infected primary effusion lymphoma (PEL) cell lines. Expression of K10/10.1 protein was induced by phorbol ester in KSHV-infected cells. A reporter gene assay demonstrated that K10/10.1 protein did not influence promoter activity of human interferon genes, regardless of its homology to human IRFs. Poly(A)-binding protein (PABP) was identified as a partner of K10/10.1 protein. Immunoprecipitation revealed that K10/10.1 protein interacted with PABP specifically in PEL cell lines. IFA revealed co-localization of K10/10.1 protein and PABP in the nucleus of KSHV-infected cells. These data suggest that K10/10.1 protein may affect the translational status or stability of mRNA in host cells.

    Virology 2006;352;1;100-9

  • Gene expression analysis of zebrafish heart regeneration.

    Lien CL, Schebesta M, Makino S, Weber GJ and Keating MT

    Department of Cardiology, Children's Hospital, Boston, Massachusetts, USA. lien@enders.tch.harvard.edu

    Mammalian hearts cannot regenerate. In contrast, zebrafish hearts regenerate even when up to 20% of the ventricle is amputated. The mechanism of zebrafish heart regeneration is not understood. To systematically characterize this process at the molecular level, we generated transcriptional profiles of zebrafish cardiac regeneration by microarray analyses. Distinct gene clusters were identified based on temporal expression patterns. Genes coding for wound response/inflammatory factors, secreted molecules, and matrix metalloproteinases are expressed in regenerating heart in sequential patterns. Comparisons of gene expression profiles between heart and fin regeneration revealed a set of regeneration core molecules as well as tissue-specific factors. The expression patterns of several secreted molecules around the wound suggest that they play important roles in heart regeneration. We found that both platelet-derived growth factor-a and -b (pdgf-a and pdgf-b) are upregulated in regenerating zebrafish hearts. PDGF-B homodimers induce DNA synthesis in adult zebrafish cardiomyocytes. In addition, we demonstrate that a chemical inhibitor of PDGF receptor decreases DNA synthesis of cardiomyocytes both in vitro and in vivo during regeneration. Our data indicate that zebrafish heart regeneration is associated with sequentially upregulated wound healing genes and growth factors and suggest that PDGF signaling is required.

    Funded by: NHLBI NIH HHS: SCCOR RFA HL02-027

    PLoS biology 2006;4;8;e260

  • Regulation of poly(A) binding protein function in translation: Characterization of the Paip2 homolog, Paip2B.

    Berlanga JJ, Baass A and Sonenberg N

    Department of Biochemistry and McGill Cancer Center, McGill University, Montréal, Québec, Canada. jberlanga@cbm.uam.es

    The 5' cap and 3' poly(A) tail of eukaryotic mRNAs act synergistically to enhance translation. This synergy is mediated via interactions between eIF4G (a component of the eIF4F cap binding complex) and poly(A) binding protein (PABP). Paip2 (PABP-interacting protein 2) binds PABP and inhibits translation both in vitro and in vivo by decreasing the affinity of PABP for polyadenylated RNA. Here, we describe the functional characteristics of Paip2B, a Paip2 homolog. A full-length brain cDNA of Paip2B encodes a protein that shares 59% identity and 80% similarity with Paip2 (Paip2A), with the highest conservation in the two PABP binding domains. Paip2B acts in a manner similar to Paip2A to inhibit translation of capped and polyadenylated mRNAs both in vitro and in vivo by displacing PABP from the poly(A) tail. Also, similar to Paip2A, Paip2B does not affect the translation mediated by the internal ribosome entry site (IRES) of hepatitis C virus (HCV). However, Paip2A and Paip2B differ with respect to both mRNA and protein distribution in different tissues and cell lines. Paip2A is more highly ubiquitinated than is Paip2B and is degraded more rapidly by the proteasome. Paip2 protein degradation may constitute a primary mechanism by which cells regulate PABP activity in translation.

    Funded by: NIGMS NIH HHS: R01 GM066157, R01 GM66157

    RNA (New York, N.Y.) 2006;12;8;1556-68

  • Cleavage, a real turn-off? HIV-mediated proteolysis of PABP1.

    Collier B and Gray NK

    MRC Human Genetics Unit, Western General Hospital, Edinburgh EH4 2XU, UK.

    In this issue of the Biochemical Journal, Alvarez and colleagues have identified PABP1 [poly(A)-binding protein 1] as a target of protease cleavage during HIV infection. The study shows that HIV-1, HIV-2 and mouse mammary tumour virus, but not other retroviruses, target PABP1 for cleavage and identifies cleavage sites within the RNA-recognition motifs and C-terminal region of the protein. This suggests that PABP1 cleavage may be important in the shut-off of host translation during HIV infection. This extends the viral families that are known to target PABP1 to include Retroviridae, suggesting that PABP1 may be a central target of viral infection.

    Funded by: Medical Research Council: G117/564

    The Biochemical journal 2006;396;2;e9-11

  • HIV protease cleaves poly(A)-binding protein.

    Alvarez E, Castelló A, Menéndez-Arias L and Carrasco L

    Centro de Biología Molecular Severo Ochoa (CSIC-UAM), Facultad de Ciencias, Universidad Autónoma, Cantoblanco, 28049 Madrid, Spain. ealvarez@cnb.uam.es

    The PABP [poly(A)-binding protein] is able to interact with the 3' poly(A) tail of eukaryotic mRNA, promoting its translation. Cleavage of PABP by viral proteases encoded by several picornaviruses and caliciviruses plays a role in the abrogation of cellular protein synthesis. We report that infection of MT-2 cells with HIV-1 leads to efficient proteolysis of PABP. Analysis of PABP integrity was carried out in BHK-21 (baby-hamster kidney) and COS-7 cells upon individual expression of the protease from several members of the Retroviridae family, e.g. MoMLV (Moloney murine leukaemia virus), MMTV (mouse mammary tumour virus), HTLV-I (human T-cell leukaemia virus type I), SIV (simian immunodeficiency virus), HIV-1 and HIV-2. Moreover, protease activity against PABP was tested in a HeLa-cell-free system. Only MMTV, HIV-1 and HIV-2 proteases were able to cleave PABP in the absence of other viral proteins. Purified HIV-1 and HIV-2 proteases cleave PABP1 directly at positions 237 and 477, separating the two first RNA-recognition motifs from the C-terminal domain of PABP. An additional cleavage site located at position 410 was detected for HIV-2 protease. These findings indicate that some retroviruses may share with picornaviruses and caliciviruses the capacity to proteolyse PABP.

    The Biochemical journal 2006;396;2;219-26

  • Poly(A) binding protein (PABP) homeostasis is mediated by the stability of its inhibitor, Paip2.

    Yoshida M, Yoshida K, Kozlov G, Lim NS, De Crescenzo G, Pang Z, Berlanga JJ, Kahvejian A, Gehring K, Wing SS and Sonenberg N

    Department of Biochemistry, McGill University, Montreal, Quebec, Canada.

    The poly(A)-binding protein (PABP) is a unique translation initiation factor in that it binds to the mRNA 3' poly(A) tail and stimulates recruitment of the ribosome to the mRNA at the 5' end. PABP activity is tightly controlled by the PABP-interacting protein 2 (Paip2), which inhibits translation by displacing PABP from the mRNA. Here, we describe a close interplay between PABP and Paip2 protein levels in the cell. We demonstrate a mechanism for this co-regulation that involves an E3 ubiquitin ligase, EDD, which targets Paip2 for degradation. PABP depletion by RNA interference (RNAi) causes co-depletion of Paip2 protein without affecting Paip2 mRNA levels. Upon PABP knockdown, Paip2 interacts with EDD, which leads to Paip2 ubiquitination. Supporting a critical role for EDD in Paip2 degradation, knockdown of EDD expression by siRNA leads to an increase in Paip2 protein stability. Thus, we demonstrate that the turnover of Paip2 in the cell is mediated by EDD and is regulated by PABP. This mechanism serves as a homeostatic feedback to control the activity of PABP in cells.

    Funded by: NIGMS NIH HHS: 5R01 GM66157-03, R01 GM066157

    The EMBO journal 2006;25;9;1934-44

  • Assembly of AUF1 with eIF4G-poly(A) binding protein complex suggests a translation function in AU-rich mRNA decay.

    Lu JY, Bergman N, Sadri N and Schneider RJ

    Department of Microbiology, New York University School of Medicine, New York, New York 10016, USA.

    An AU-rich element (ARE) located in the 3'-untranslated region of many short-lived mRNAs functions as an instability determinant for these transcripts. AUF1/hnRNP D, an ARE-binding protein family consisting of four isoforms, promotes rapid decay of ARE-mRNAs. The mechanism by which AUF1 promotes rapid decay of ARE-mRNA is unclear. AUF1 has been shown to form an RNase-resistant complex in cells with the cap-initiation complex and heat shock proteins Hsp70 and Hsc70, as well as other unidentified factors. To understand the function of the AUF1 complex, we have biochemically investigated the association of AUF1 with the components of the translation initiation complex. We used purified recombinant proteins and a synthetic ARE RNA oligonucleotide to determine the hierarchy of protein interactions in vitro and the effect of AUF1 binding to the ARE on the formation of protein complexes. We demonstrate that all four AUF1 protein isoforms bind directly and strongly to initiation factor eIF4G at a C-terminal site regardless of AUF1 interaction with the ARE. AUF1 is shown to directly interact with poly(A) binding protein (PABP), both independently of eIF4G and in a complex with eIF4G. AUF1-PABP interaction is opposed by AUF1 binding to the ARE or Hsp70 heat shock protein. In vivo, AUF1 interaction with PABP does not alter PABP stability. Based on these and other data, we propose a model for the molecular interactions of AUF1 that involves translation-dependent displacement of AUF1-PABP complexes from ARE-mRNAs with possible unmasking of the poly(A) tail.

    Funded by: NIGMS NIH HHS: GM60428, R01 GM060428

    RNA (New York, N.Y.) 2006;12;5;883-93

  • Expression and prognostic roles of PABPC1 in esophageal cancer: correlation with tumor progression and postoperative survival.

    Takashima N, Ishiguro H, Kuwabara Y, Kimura M, Haruki N, Ando T, Kurehara H, Sugito N, Mori R and Fujii Y

    Department of Surgery II, Nagoya City University Medical School, Nagoya 467-8601, Japan.

    The prognosis of patients with esophageal cancer remains poor. TNM classification is not sufficient to predict their prognosis, and novel predictive markers of the prognosis of esophageal cancer patients are therefore needed. Poly A binding protein, cytoplasmic 1 (PABPC1) plays a role in post-transcriptional control of mRNA and may be involved in tumorigenesis. PABPC1 expression has not been studied in esophageal cancer. Expression of PABPC1 was quantified by real-time reverse transcription polymerase chain reaction (RT-PCR) using LightCycler in 41 primary esophageal squamous cell carcinomas (ESCCs) and their paired normal esophageal mucosa. We examined the correlation between PABPC1 expression and the clinicopathological factors and prognosis of ESCC patients. Reduced expression of PABPC1 was accompanied by locally invasive tumors (t-factor, p=0.0145) and more advanced tumors (pathologic stage, p=0.0264). Moreover, ESCC patients with low PABPC1 mRNA expression had a significantly shorter postoperative survival time than those with high expression (median survival, 3.1 vs. 6.5 months, p=0.002). In esophageal cancer, reduced expression of PABPC1 was correlated with local tumor progression and poor prognosis after surgery.

    Oncology reports 2006;15;3;667-71

  • Reduced stability of mitogen-activated protein kinase kinase-2 mRNA and phosphorylation of poly(A)-binding protein (PABP) in cells overexpressing PABP.

    Ma S, Musa T and Bag J

    Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario N1G 2W1, Canada.

    The poly(A)-binding protein (PABP) is an important regulator of mRNA translation and stability. The cellular level of PABP is controlled by regulating its mRNA translation by a feedback mechanism. The important aspect of this mechanism is that PABP binds to an adenosine-rich cis-element at the 5'-untranslated region of its own mRNA and inhibits its translation. To assess the importance of controlling the PABP level, we studied the effect of PABP overexpression on the transcription profile using the microarray technique. In PABP-overexpressing cells, 19 mRNAs showed a reduction in cellular levels due to reduced mRNA stability, and one showed an increase due to increased mRNA stability. Among these mRNAs, the MKK-2 mRNA encodes the protein kinase activator of ERK1/2 kinase, which is involved in the phosphorylation of eukaryotic initiation factor (eIF) 4E. As a result, mRNA translation may be regulated by the cellular level of MKK-2. In this study, we show that the abundance of the MKK-2 polypeptide is reduced in PABP-overexpressing cells. In these cells, the levels of phosphorylated PABP, eIF4E, and ERK2 are also reduced. Treatment of HeLa cells with the MKK-2 inhibitor U0126 reduced PABP phosphorylation, suggesting that the phosphorylation of PABP is mediated by the MKK-2/ERK signaling pathway. Thus, a novel signaling pathway involving MKK-2 and ERK1/2 may down-regulate the activity of PABP and eIF4E by controlling their phosphorylation and compensates for the effect of excess cellular PABP.

    The Journal of biological chemistry 2006;281;6;3145-56

  • Crystallization of auto-regulatory A-rich repeats found in the 5'-UTR of human PABP mRNA.

    Kikuchi K, Sato Y, Juan EC and Takénaka A

    Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8501, Japan.

    Eukaryotic poly(A)-binding protein (PABP) binds not only to the 3' poly(A) tail of most mRNAs, but also to the 5'-untranslated region (UTR). The latter form of binding leads to auto-regulation of PABP expression. The 5'-UTR sequence contains A-rich repeats different from that in 3'-UTR. The role of these A-rich repeats in auto-regulation, however, remains unknown. To confirm that the 5'-UTR sequence has a specific structure before or after PABP binding, and to determine the function of such structure, several RNA/DNA fragments containing A-rich repeats were examined by crystallization, fluorescence microscopy and X-ray diffraction. Crystals were obtained for several of these fragments. In particular, single crystals were obtained for the DNA fragment with four repeats, suggesting that such fragment is folded into a regular structure through A:A interactions.

    Nucleic acids symposium series (2004) 2006;50;217-8

  • Interaction of paxillin with poly(A)-binding protein 1 and its role in focal adhesion turnover and cell migration.

    Woods AJ, Kantidakis T, Sabe H, Critchley DR and Norman JC

    Department of Biochemistry, University of Leicester, University Road, Leicester LE1 7 RH, United Kingdom.

    We have previously identified poly(A)-binding protein 1 (PABP1) as a ligand for paxillin and shown that the paxillin-PABP1 complex undergoes nucleocytoplasmic shuttling. By targeting the paxillin-binding subdomain sequences in PABP1, we have generated mutants of PABP1 that do not bind to cellular paxillin. Here we report that paxillin association is necessary for efficient nuclear export of PABP1 and that RNA interference of paxillin drives the nuclear accumulation of PABP1. Furthermore, ablation of paxillin-PABP1 association impeded a number of indices of cell motility including spreading on fibronectin, cell migration on two-dimensional matrices, and transmigration in Boyden chambers. These data indicate that PABP1 must associate with paxillin in order to be efficiently transported from the nucleus to the cytoplasm and that this event is necessary for cells to remodel their focal adhesions during cell migration.

    Molecular and cellular biology 2005;25;9;3763-73

  • An integrative approach to gain insights into the cellular function of human ataxin-2.

    Ralser M, Albrecht M, Nonhoff U, Lengauer T, Lehrach H and Krobitsch S

    Max Planck Institute for Molecular Genetics, Ihnestrasse 73, 14195 Berlin, Germany.

    Spinocerebellar ataxia type 2 (SCA2) is a hereditary neurodegenerative disorder caused by a trinucleotide expansion in the SCA2 gene, encoding a polyglutamine stretch in the gene product ataxin-2 (ATX2), whose cellular function is unknown. However, ATX2 interacts with A2BP1, a protein containing an RNA-recognition motif, and the existence of an interaction motif for the C-terminal domain of the poly(A)-binding protein (PABC) as well as an Lsm (Like Sm) domain in ATX2 suggest that ATX2 like its yeast homolog Pbp1 might be involved in RNA metabolism. Here, we show that, similar to Pbp1, ATX2 suppresses the petite (pet-) phenotype of Deltamrs2 yeast strains lacking mitochondrial group II introns. This finding points to a close functional relationship between the two homologs. To gain insight into potential functions of ATX2, we also generated a comprehensive protein interaction network for Pbp1 from publicly available databases, which implicates Pbp1 in diverse RNA-processing pathways. The functional relationship of ATX2 and Pbp1 is further corroborated by the experimental confirmation of the predicted interaction of ATX2 with the cytoplasmic poly(A)-binding protein 1 (PABP) using yeast-2-hybrid analysis as well as co-immunoprecipitation experiments. Immunofluorescence studies revealed that ATX2 and PABP co-localize in mammalian cells, remarkably, even under conditions in which PABP accumulates in distinct cytoplasmic foci representing sites of mRNA triage.

    Journal of molecular biology 2005;346;1;203-14

  • Immunoaffinity profiling of tyrosine phosphorylation in cancer cells.

    Rush J, Moritz A, Lee KA, Guo A, Goss VL, Spek EJ, Zhang H, Zha XM, Polakiewicz RD and Comb MJ

    Cell Signaling Technology Inc., 166B Cummings Center, Beverly, Massachusetts 01915, USA.

    Tyrosine kinases play a prominent role in human cancer, yet the oncogenic signaling pathways driving cell proliferation and survival have been difficult to identify, in part because of the complexity of the pathways and in part because of low cellular levels of tyrosine phosphorylation. In general, global phosphoproteomic approaches reveal small numbers of peptides containing phosphotyrosine. We have developed a strategy that emphasizes the phosphotyrosine component of the phosphoproteome and identifies large numbers of tyrosine phosphorylation sites. Peptides containing phosphotyrosine are isolated directly from protease-digested cellular protein extracts with a phosphotyrosine-specific antibody and are identified by tandem mass spectrometry. Applying this approach to several cell systems, including cancer cell lines, shows it can be used to identify activated protein kinases and their phosphorylated substrates without prior knowledge of the signaling networks that are activated, a first step in profiling normal and oncogenic signaling networks.

    Funded by: NCI NIH HHS: 1R43CA101106

    Nature biotechnology 2005;23;1;94-101

  • The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex.

    Patel GP, Ma S and Bag J

    Department of Molecular and Cellular Biology, University of Guelph Guelph, Ontario, Canada, N1G 2W1.

    Repression of poly(A)-binding protein (PABP) mRNA translation involves the binding of PABP to the adenine-rich autoregulatory sequence (ARS) in the 5'-untranslated region of its own mRNA. In this report, we show that the ARS forms a complex in vitro with PABP, and two additional polypeptides of 63 and 105 kDa. The 63 and 105 kDa polypeptides were identified, as IMP1, an ortholog of chicken zip-code binding polypeptide, and UNR, a PABP binding polypeptide, respectively, by mass spectrometry of the ARS RNA affinity purified samples. Using a modified ribonucleoprotein (RNP) immunoprecipitation procedure we further show that indeed, both IMP1 and UNR bind to the ARS containing reporter RNA in vivo. Although both IMP1 and UNR could bind independently to the ARS RNA in vitro, their RNA-binding ability was stimulated by PABP. Mutational analyses of the ARS show that the presence of four of the six oligo(A) regions of the ARS was sufficient to repress translation and the length of the conserved pyrimidine spacers between the oligo(A) sequences was important for ARS function. The ability of mutant ARS RNAs to form the PABP, IMP1 and UNR containing RNP complex correlates well with the translational repressor activity of the ARS. There is also a direct relationship between the length of the poly(A) RNAs and their ability to form a trimeric complex with PABP, and to repress mRNA translation. UV crosslinking studies suggest that the ARS is less efficient than a poly(A) RNA of similar length, to bind to PABP. We show here that the ARS cannot efficiently form a trimeric complex with PABP; therefore, additional interactions with IMP1 and UNR to form a heteromeric RNP complex may be required for maximal repression of PABP mRNA translation under physiological conditions.

    Nucleic acids research 2005;33;22;7074-89

  • Identifying and quantifying in vivo methylation sites by heavy methyl SILAC.

    Ong SE, Mittler G and Mann M

    Center for Experimental BioInformatics, University of Southern Denmark, Odense M 5230, Denmark.

    Protein methylation is a stable post-translational modification (PTM) with important biological functions. It occurs predominantly on arginine and lysine residues with varying numbers of methyl groups, such as mono-, di- or trimethyl lysine. Existing methods for identifying methylation sites are laborious, require large amounts of sample and cannot be applied to complex mixtures. We have previously described stable isotope labeling by amino acids in cell culture (SILAC) for quantitative comparison of proteomes. In heavy methyl SILAC, cells metabolically convert [(13)CD(3)]methionine to the sole biological methyl donor, [(13)CD(3)]S-adenosyl methionine. Heavy methyl groups are fully incorporated into in vivo methylation sites, directly labeling the PTM. This provides markedly increased confidence in identification and relative quantitation of protein methylation by mass spectrometry. Using antibodies targeted to methylated residues and analysis by liquid chromatography-tandem mass spectrometry, we identified 59 methylation sites, including previously unknown sites, considerably extending the number of in vivo methylation sites described in the literature.

    Nature methods 2004;1;2;119-26

  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).

    Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Morrin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J and MGC Project Team

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.

    Funded by: PHS HHS: N01-C0-12400

    Genome research 2004;14;10B;2121-7

  • Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization.

    Jin J, Smith FD, Stark C, Wells CD, Fawcett JP, Kulkarni S, Metalnikov P, O'Donnell P, Taylor P, Taylor L, Zougman A, Woodgett JR, Langeberg LK, Scott JD and Pawson T

    Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada.

    Background: 14-3-3 proteins are abundant and conserved polypeptides that mediate the cellular effects of basophilic protein kinases through their ability to bind specific peptide motifs phosphorylated on serine or threonine.

    Results: We have used mass spectrometry to analyze proteins that associate with 14-3-3 isoforms in HEK293 cells. This identified 170 unique 14-3-3-associated proteins, which show only modest overlap with previous 14-3-3 binding partners isolated by affinity chromatography. To explore this large set of proteins, we developed a domain-based hierarchical clustering technique that distinguishes structurally and functionally related subsets of 14-3-3 target proteins. This analysis revealed a large group of 14-3-3 binding partners that regulate cytoskeletal architecture. Inhibition of 14-3-3 phosphoprotein recognition in vivo indicates the general importance of such interactions in cellular morphology and membrane dynamics. Using tandem proteomic and biochemical approaches, we identify a phospho-dependent 14-3-3 binding site on the A kinase anchoring protein (AKAP)-Lbc, a guanine nucleotide exchange factor (GEF) for the Rho GTPase. 14-3-3 binding to AKAP-Lbc, induced by PKA, suppresses Rho activation in vivo.

    Conclusion: 14-3-3 proteins can potentially engage around 0.6% of the human proteome. Domain-based clustering has identified specific subsets of 14-3-3 targets, including numerous proteins involved in the dynamic control of cell architecture. This notion has been validated by the broad inhibition of 14-3-3 phosphorylation-dependent binding in vivo and by the specific analysis of AKAP-Lbc, a RhoGEF that is controlled by its interaction with 14-3-3.

    Funded by: NIDDK NIH HHS: DK44239

    Current biology : CB 2004;14;16;1436-50

  • UNR, a new partner of poly(A)-binding protein, plays a key role in translationally coupled mRNA turnover mediated by the c-fos major coding-region determinant.

    Chang TC, Yamashita A, Chen CY, Yamashita Y, Zhu W, Durdan S, Kahvejian A, Sonenberg N and Shyu AB

    Department of Biochemistry and Molecular Biology, The University of Texas Medical School, Houston 77030, USA.

    Messenger RNA decay mediated by the c-fos major protein coding-region determinant of instability (mCRD) is a useful system for studying translationally coupled mRNA turnover. Among the five mCRD-associated proteins identified previously, UNR was found to be an mCRD-binding protein and also a PABP-interacting protein. Interaction between UNR and PABP is necessary for the full destabilization function of the mCRD. By testing different classes of mammalian poly(A) nucleases, we identified CCR4 as a poly(A) nuclease involved in the mCRD-mediated rapid deadenylation in vivo and also associated with UNR. Blocking either translation initiation or elongation greatly impeded poly(A) shortening and mRNA decay mediated by the mCRD, demonstrating that the deadenylation step is coupled to ongoing translation of the message. These findings suggest a model in which the mCRD/UNR complex serves as a "landing/assembly" platform for formation of a deadenylation/decay mRNA-protein complex on an mCRD-containing transcript. The complex is dormant prior to translation. Accelerated deadenylation and decay of the transcript follows ribosome transit through the mCRD. This study provides new insights into a mechanism by which interplay between mRNA turnover and translation determines the lifespan of an mCRD-containing mRNA in the cytoplasm.

    Funded by: NIGMS NIH HHS: GM 46454, GM 59211, R01 GM046454

    Genes & development 2004;18;16;2010-23

  • The Apc5 subunit of the anaphase-promoting complex/cyclosome interacts with poly(A) binding protein and represses internal ribosome entry site-mediated translation.

    Koloteva-Levine N, Pinchasi D, Pereman I, Zur A, Brandeis M and Elroy-Stein O

    Department of Cell Research & Immunology, George S. Wise Faculty of Life Science, Tel Aviv University, Tel Aviv, Israel.

    The anaphase-promoting complex/cyclosome (APC/C) is a multisubunit ubiquitin ligase that mediates the proteolysis of cell cycle proteins in mitosis and G(1). We used a yeast three-hybrid screen to identify proteins that interact with the internal ribosome entry site (IRES) of platelet-derived growth factor 2 mRNA. Surprisingly, this screen identified Apc5, although it does not harbor a classical RNA binding domain. We found that Apc5 binds the poly(A) binding protein (PABP), which directly binds the IRES element. PABP was found to enhance IRES-mediated translation, whereas Apc5 overexpression counteracted this effect. In addition to its association with the APC/C complex, Apc5 binds much heavier complexes and cosediments with the ribosomal fraction. In contrast to Apc3, which is associated only with the APC/C and remains intact during differentiation, Apc5 is degraded upon megakaryocytic differentiation in correlation with IRES activation. Expression of Apc5 in differentiated cells abolished IRES activation. This is the first report implying an additional role for an APC/C subunit, apart from its being part of the APC/C complex.

    Molecular and cellular biology 2004;24;9;3577-87

  • Identification of a human cytoplasmic poly(A) nuclease complex stimulated by poly(A)-binding protein.

    Uchida N, Hoshino S and Katada T

    Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033, Japan.

    The poly(A) tail shortening in mRNA, called deadenylation, is the first rate-limiting step in eukaryotic mRNA turnover, and the polyadenylate-binding protein (PABP) appears to be involved in the regulation of this step. However, the precise role of PABP remains largely unknown in higher eukaryotes. Here we identified and characterized a human PABP-dependent poly(A) nuclease (hPAN) complex consisting of catalytic hPan2 and regulatory hPan3 subunits. hPan2 has intrinsically a 3' to 5' exoribonuclease activity and requires Mg2+ for the enzyme activity. On the other hand, hPan3 interacts with PABP to simulate hPan2 nuclease activity. Interestingly, the hPAN nuclease complex has a higher substrate specificity to poly(A) RNA upon its association with PABP. Consistent with the roles of hPan2 and hPan3 in mRNA decay, the two subunits exhibit cytoplasmic co-localization. Thus, the human PAN complex is a poly(A)-specific exoribonuclease that is stimulated by PABP in the cytoplasm.

    The Journal of biological chemistry 2004;279;2;1383-91

  • Complete sequencing and characterization of 21,243 full-length human cDNAs.

    Ota T, Suzuki Y, Nishikawa T, Otsuki T, Sugiyama T, Irie R, Wakamatsu A, Hayashi K, Sato H, Nagai K, Kimura K, Makita H, Sekine M, Obayashi M, Nishi T, Shibahara T, Tanaka T, Ishii S, Yamamoto J, Saito K, Kawai Y, Isono Y, Nakamura Y, Nagahari K, Murakami K, Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T, Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi T, Furuya T, Kikkawa E, Omura Y, Abe K, Kamihara K, Katsuta N, Sato K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H, Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S, Chiba Y, Ishida S, Ono Y, Takiguchi S, Watanabe S, Yosida M, Hotuta T, Kusano J, Kanehori K, Takahashi-Fujii A, Hara H, Tanase TO, Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, Arita M, Imose N, Musashino K, Yuuki H, Oshima A, Sasaki N, Aotsuka S, Yoshikawa Y, Matsunawa H, Ichihara T, Shiohata N, Sano S, Moriya S, Momiyama H, Satoh N, Takami S, Terashima Y, Suzuki O, Nakagawa S, Senoh A, Mizoguchi H, Goto Y, Shimizu F, Wakebe H, Hishigaki H, Watanabe T, Sugiyama A, Takemoto M, Kawakami B, Yamazaki M, Watanabe K, Kumagai A, Itakura S, Fukuzumi Y, Fujimori Y, Komiyama M, Tashiro H, Tanigami A, Fujiwara T, Ono T, Yamada K, Fujii Y, Ozaki K, Hirao M, Ohmori Y, Kawabata A, Hikiji T, Kobatake N, Inagaki H, Ikema Y, Okamoto S, Okitani R, Kawakami T, Noguchi S, Itoh T, Shigeta K, Senba T, Matsumura K, Nakajima Y, Mizuno T, Morinaga M, Sasaki M, Togashi T, Oyama M, Hata H, Watanabe M, Komatsu T, Mizushima-Sugano J, Satoh T, Shirai Y, Takahashi Y, Nakagawa K, Okumura K, Nagase T, Nomura N, Kikuchi H, Masuho Y, Yamashita R, Nakai K, Yada T, Nakamura Y, Ohara O, Isogai T and Sugano S

    Helix Research Institute, 1532-3 Yana, Kisarazu, Chiba 292-0812, Japan.

    As a base for human transcriptome and functional genomics, we created the "full-length long Japan" (FLJ) collection of sequenced human cDNAs. We determined the entire sequence of 21,243 selected clones and found that 14,490 cDNAs (10,897 clusters) were unique to the FLJ collection. About half of them (5,416) seemed to be protein-coding. Of those, 1,999 clusters had not been predicted by computational methods. The distribution of GC content of nonpredicted cDNAs had a peak at approximately 58% compared with a peak at approximately 42%for predicted cDNAs. Thus, there seems to be a slight bias against GC-rich transcripts in current gene prediction procedures. The rest of the cDNAs unique to the FLJ collection (5,481) contained no obvious open reading frames (ORFs) and thus are candidate noncoding RNAs. About one-fourth of them (1,378) showed a clear pattern of splicing. The distribution of GC content of noncoding cDNAs was narrow and had a peak at approximately 42%, relatively low compared with that of protein-coding cDNAs.

    Nature genetics 2004;36;1;40-5

  • Degradation of poly(A)-binding protein in apoptotic cells and linkage to translation regulation.

    Marissen WE, Triyoso D, Younan P and Lloyd RE

    Department of Molecular Virology and Microbiology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.

    We have recently shown that poly(A)-binding protein (PABP) is cleaved during poliovirus and Coxsackievirus infection by viral 3Cprotease and that 3Cprotease modification of a subset of PABP can result in significant translation inhibition. During apoptosis, translation undergoes significant down-regulation that correlates with caspase-3 mediated cleavage of several translation factors, including eIF4G, 4EBP1 and eIF2alpha. The fate of PABP in apoptotic cells has not yet been examined. Here we show that PABP levels decline significantly via proteolytic degradation in apoptotic HeLa, Jurkat and MCF7 cells. The degradation of PABP correlated with translation inhibition but lagged behind cleavage of eIF4GI. In apoptotic MCF7 cells translation inhibition occurred without modification of most translation factors and correlated with PABP degradation. PABP was not cleaved during incubation with several caspases, yet caspase 3 induced weak PABP degradative activity in cells lysates. Both the caspase inhibitor zVAD and calpain inhibitors blocked PABP cleavage in vivo, while the proteosome inhibitor MG132 induced PABP degradation. Protease(s) activated during apoptosis preferentially degraded PABP associated with ribosomes and translation factors, but not PABP in other cellular compartments. The data suggest that targeted degradation of PABP contributes to translation inhibition in apoptotic cells.

    Funded by: NIAID NIH HHS: AI50237; NIGMS NIH HHS: GM59803

    Apoptosis : an international journal on programmed cell death 2004;9;1;67-75

  • The composition of Staufen-containing RNA granules from human cells indicates their role in the regulated transport and translation of messenger RNAs.

    Villacé P, Marión RM and Ortín J

    Centro Nacional de Biotecnología, Campus de Cantoblanco, 28049 Madrid, Spain.

    hStaufen is the human homolog of dmStaufen, a double-stranded (ds)RNA-binding protein involved in early development of the fly. hStaufen-containing complexes were purified by affinity chromatography from human cells transfected with a TAP-tagged hStaufen gene. These complexes showed a size >10 MDa. Untagged complexes with similar size were identified from differentiated human neuroblasts. The identity of proteins present in purified hStaufen complexes was determined by mass spectrometry and the presence of these proteins and other functionally related ones was verified by western blot. Ribosomes and proteins involved in the control of protein synthesis (PABP1 and FMRP) were present in purified hStaufen complexes, as well as elements of the cytoskeleton (tubulins, tau, actin and internexin), cytoskeleton control proteins (IQGAP1, cdc42 and rac1) and motor proteins (dynein, kinesin and myosin). In addition, proteins normally found in the nucleus, like nucleolin and RNA helicase A, were also found associated with cytosolic hStaufen complexes. The co-localization of these components with hStaufen granules in the dendrites of differentiated neuroblasts, determined by confocal immunofluorescence, validated their association in living cells. These results support the notion that the hStaufen-containing granules are structures essential in the localization and regulated translation of human mRNAs in vivo.

    Nucleic acids research 2004;32;8;2411-20

  • Regulation of alternative splicing by SRrp86 and its interacting proteins.

    Li J, Hawkins IC, Harvey CD, Jennings JL, Link AJ and Patton JG

    Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee 37235, USA.

    SRrp86 is a unique member of the SR protein superfamily containing one RNA recognition motif and two serine-arginine (SR)-rich domains separated by an unusual glutamic acid-lysine (EK)-rich region. Previously, we showed that SRrp86 could regulate alternative splicing by both positively and negatively modulating the activity of other SR proteins and that the unique EK domain could inhibit both constitutive and alternative splicing. These functions were most consistent with the model in which SRrp86 functions by interacting with and thereby modulating the activity of target proteins. To identify the specific proteins that interact with SRrp86, we used a yeast two-hybrid library screen and immunoprecipitation coupled to mass spectrometry. We show that SRrp86 interacts with all of the core SR proteins, as well as a subset of other splicing regulatory proteins, including SAF-B, hnRNP G, YB-1, and p72. In contrast to previous results that showed activation of SRp20 by SRrp86, we now show that SAF-B, hnRNP G, and 9G8 all antagonize the activity of SRrp86. Overall, we conclude that not only does SRrp86 regulate SR protein activity but that it is, in turn, regulated by other splicing factors to control alternative splice site selection.

    Funded by: NIGMS NIH HHS: GM62487, R01 GM062487

    Molecular and cellular biology 2003;23;21;7437-47

  • Complexes between the nonsense-mediated mRNA decay pathway factor human upf1 (up-frameshift protein 1) and essential nonsense-mediated mRNA decay factors in HeLa cells.

    Schell T, Köcher T, Wilm M, Seraphin B, Kulozik AE and Hentze MW

    European Molecular Biology Laboratory Heidelberg, Gene Expression Programme, Meyerhofstrasse 1, 69117 Heidelberg, Germany.

    mRNAs harbouring premature translation-termination codons are usually degraded by the nonsense-mediated mRNA decay (NMD) pathway. Human up-frameshift protein 1 (Hupf1) is an NMD factor that is conserved between yeast and mammals. To isolate cellular complexes that are formed with Hupf1 and to explore the role of cellular proteins in NMD, we generated a HeLa cell line that stably expresses Hupf1 bearing a double-affinity tag (termed Hupf1-2tag). Hupf1-2tag is localized in the cytoplasm similar to the endogenous Hupf1 protein, and the Hupf1-2tag cell line is fully NMD-competent. Using affinity chromatography, Hupf1-2tag-associated proteins were isolated. MS and immunoblotting identified the NMD factors Hupf2 and Hupf3a/b as interaction partners of Hupf1. Size-exclusion chromatography indicates that the NMD factors Hupf1, Hupf2 and the large isoform of Hupf3a might exist in a stable, high-molecular-mass complex of approx. 1.3 MDa. Interestingly, the poly(A)-binding protein was also identified by MS to be associated specifically with Hupf1-2tag. In contrast with the interaction with Hupf2 and Hupf3a/b, the association of poly(A)-binding protein with Hupf1 is highly sensitive to treatment of the isolated complexes with RNase. Components of the exon-exon junction complex or the translational eukaryotic release factor (eRF) 3 were not identified in complexes associated with Hupf1-2tag. We discuss these findings in the context of current models of NMD.

    The Biochemical journal 2003;373;Pt 3;775-83

  • Transcript-selective translational silencing by gamma interferon is directed by a novel structural element in the ceruloplasmin mRNA 3' untranslated region.

    Sampath P, Mazumder B, Seshadri V and Fox PL

    Department of Cell Biology, The Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195, USA.

    Transcript-selective translational control of eukaryotic gene expression is often directed by a structural element in the 3' untranslated region (3'-UTR) of the mRNA. In the case of ceruloplasmin (Cp), induced synthesis of the protein by gamma interferon (IFN-gamma) in U937 monocytic cells is halted by a delayed translational silencing mechanism requiring the binding of a cytosolic inhibitor to the Cp 3'-UTR. Silencing requires the essential elements of mRNA circularization, i.e., eukaryotic initiation factor 4G, poly(A)-binding protein, and poly(A) tail. We here determined the minimal silencing element in the Cp 3'-UTR by progressive deletions from both termini. A minimal, 29-nucleotide (nt) element was determined by gel shift assay to be sufficient for maximal binding of the IFN-gamma-activated inhibitor of translation (GAIT), an as-yet-unidentified protein or complex. The interaction was shown to be functional by an in vitro translation assay in which the GAIT element was used as a decoy to overcome translational silencing. Mutation analysis showed that the GAIT element contained a 5-nt terminal loop, a weak 3-bp helix, an asymmetric internal bulge, and a proximal 6-bp helical stem. Two invariant loop residues essential for binding activity were identified. Ligation of the GAIT element immediately downstream of a luciferase reporter conferred the translational silencing response to the heterologous transcript in vitro and in vivo; a construct containing a nonbinding, mutated GAIT element was ineffective. Translational silencing of Cp, and possibly other transcripts, mediated by the GAIT element may contribute to the resolution of the local inflammatory response following cytokine activation of macrophages.

    Funded by: NHLBI NIH HHS: HL29582, HL67725, P01 HL029582, R01 HL067725

    Molecular and cellular biology 2003;23;5;1509-19

  • Affinity purification of ARE-binding proteins identifies polyA-binding protein 1 as a potential substrate in MK2-induced mRNA stabilization.

    Bollig F, Winzen R, Gaestel M, Kostka S, Resch K and Holtmann H

    Institute of Pharmacology, Medical School Hannover, Germany.

    An important determinant for the expression level of cytokines and proto-oncogenes is the rate of degradation of their mRNAs. AU-rich sequence elements (AREs) in the 3(') untranslated regions have been found to impose rapid decay of these mRNAs. ARE-containing mRNAs can be stabilized in response to external signals which activate the p38 MAP kinase cascade including the p38 MAP kinase substrate MAPKAP kinase 2 (MK2). In an attempt to identify components downstream of MK2 in this pathway we analyzed several proteins which selectively interact with the ARE of GM-CSF mRNA. One of them, the cytoplasmic poly(A)-binding protein PABP1, co-migrated with a protein that showed prominent phosphorylation by recombinant MK2. Phosphorylation by MK2 was confirmed using PABP1 purified by affinity chromatography on poly(A) RNA. The selective interaction with an ARE-containing RNA and the phosphorylation by MK2 suggest that PABP1 plays a regulatory role in ARE-dependent mRNA decay and its modulation by the p38 MAP kinase cascade.

    Biochemical and biophysical research communications 2003;301;3;665-70

  • A receptor for activated C kinase is part of messenger ribonucleoprotein complexes associated with polyA-mRNAs in neurons.

    Angenstein F, Evans AM, Settlage RE, Moran ST, Ling SC, Klintsova AY, Shabanowitz J, Hunt DF and Greenough WT

    Beckman Institute/Neuronal Pattern Analysis, University of Illinois, Urbana, Illinois 61801, USA. angenstein@ifn-magdeburg.de

    Long-lasting changes in synaptic functions after an appropriate stimulus require altered protein expression at the synapse. To restrict changes in protein composition to activated synapses, proteins may be synthesized locally as a result of transmitter receptor-triggered signaling pathways. Second messenger-controlled mechanisms that affect mRNA translation are essentially unknown. Here we report that a receptor for activated C kinase, RACK1, is a component of messenger ribonucleoprotein (mRNP) complexes. RACK1 is predominantly associated with polysome-bound, polyA-mRNAs that are being actively translated. We find it to be present in a complex with beta-tubulin and at least two mRNA-binding proteins, polyA-binding protein 1 and a 130 kDa polyA-mRNA binding protein (KIAA0217). Activation of PKCbeta2 in vitro by phosphatidylserine/diacylglycerol or in hippocampal slices by metabotropic glutamate receptor stimulation increased the amount of RACK1/PKCbeta2 associated with polysome-bound polyA-mRNAs. In vitro, PKCbeta2 can phosphorylate a subset of polyA-mRNA-associated proteins that are also phosphorylated under in vivo conditions. On the basis of these findings plus the somatodendritic localization of RACK1, we hypothesize that metabotropic glutamate receptor-triggered binding of activated PKCbeta2 to mRNP complexes bound to polyA-mRNAs is involved in activity-triggered control of protein synthesis.

    Funded by: NICHD NIH HHS: HD 37175; NIGMS NIH HHS: GM 37537; NIMH NIH HHS: MH 35321

    The Journal of neuroscience : the official journal of the Society for Neuroscience 2002;22;20;8827-37

  • Poly(A)-binding protein and eRF3 are associated in vivo in human and Xenopus cells.

    Cosson B, Berkova N, Couturier A, Chabelskaya S, Philippe M and Zhouravleva G

    Université de Rennes 1, CNRS UMR 6061, IFR 97, avenue du professeur Leon Bernard, 35043 Rennes cedex, France.

    An interaction between human poly(A)-binding protein (PABP) et human eRF3 has been demonstrated using a double-hybrid approach and in vitro assays. Here, we show that the binding of both proteins is conserved through evolution. We also demonstrate that the last 39 C-terminal amino acids of PABP contain the interface that interacts with eRF3. This region includes helix 5, identified by RMN, which is conserved in all known PABPs. Lastly, we demonstrate that eRF3 et PABP molecules interact in vivo.

    Biology of the cell 2002;94;4-5;205-16

  • Paip1 interacts with poly(A) binding protein through two independent binding motifs.

    Roy G, De Crescenzo G, Khaleghpour K, Kahvejian A, O'Connor-McCourt M and Sonenberg N

    Department of Biochemistry and McGill Cancer Centre, McGill University, Montréal, Québec, Canada H3G 1Y6.

    The 3' poly(A) tail of eukaryotic mRNAs plays an important role in the regulation of translation. The poly(A) binding protein (PABP) interacts with eukaryotic initiation factor 4G (eIF4G), a component of the eIF4F complex, which binds to the 5' cap structure. The PABP-eIF4G interaction brings about the circularization of the mRNA by joining its 5' and 3' termini, thereby stimulating mRNA translation. The activity of PABP is regulated by two interacting proteins, Paip1 and Paip2. To study the mechanism of the Paip1-PABP interaction, far-Western, glutathione S-transferase pull-down, and surface plasmon resonance experiments were performed. Paip1 contains two binding sites for PABP, PAM1 and PAM2 (for PABP-interacting motifs 1 and 2). PAM2 consists of a 15-amino-acid stretch residing in the N terminus, and PAM1 encompasses a larger C-terminal acidic-amino-acid-rich region. PABP also contains two Paip1 binding sites, one located in RNA recognition motifs 1 and 2 and the other located in the C-terminal domain. Paip1 binds to PABP with a 1:1 stoichiometry and an apparent K(d) of 1.9 nM.

    Molecular and cellular biology 2002;22;11;3769-82

  • Recognition of eIF4G by rotavirus NSP3 reveals a basis for mRNA circularization.

    Groft CM and Burley SK

    Laboratory of Molecular Biophysics, New York, NY 10021, USA.

    Rotaviruses, segmented double-stranded RNA viruses, co-opt the eukaryotic translation machinery with the aid of nonstructural protein 3 (NSP3), a rotaviral functional homolog of the cellular poly(A) binding protein (PABP). NSP3 binds to viral mRNA 3' consensus sequences and circularizes mRNA via interactions with eIF4G. Here, we present the X-ray structure of the C-terminal domain of NSP3 (NSP3-C) recognizing a fragment of eIF4GI. Homodimerization of NSP3-C yields a symmetric, elongated, largely alpha-helical structure with two hydrophobic eIF4G binding pockets at the dimer interface. Site-directed mutagenesis and isothermal titration calorimetry documented that NSP3 and PABP use analogous eIF4G recognition strategies, despite marked differences in tertiary structure.

    Funded by: NIGMS NIH HHS: GM 61262

    Molecular cell 2002;9;6;1273-83

  • Purification and characterization of native spliceosomes suitable for three-dimensional structural analysis.

    Jurica MS, Licklider LJ, Gygi SR, Grigorieff N and Moore MJ

    Howard Hughes Medical Institute, Department of Biochemistry, Brandeis University, Waltham, Massachusetts 02454, USA.

    We describe characterization of spliceosomes affinity purified under native conditions. These spliceosomes consist largely of C complex containing splicing intermediates. After C complex assembly on an MS2 affinity-tagged pre-mRNA substrate containing a 3' splice site mutation, followed by RNase H digestion of earlier complexes, spliceosomes were purified by size exclusion and affinity selection. This protocol yielded 40S C complexes in sufficient quantities to visualize in negative stain by electron microscopy. Complexes purified in this way contain U2, U5, and U6 snRNAs, but very little U1 or U4 snRNA. Analysis by tandem mass spectrometry confirmed the presence of core snRNP proteins (SM and LSM), U2 and U5 snRNP-specific proteins, and the second step factors Prp16, Prp17, Slu7, and Prp22. In contrast, proteins specific to earlier splicing complexes, such as U2AF and U1 snRNP components, were not detected in C complex, but were present in similarly purified H complex. Images of these spliceosomes revealed single particles with dimensions of approximately 270 x 240 A that assort into well-defined classes. These images represent an important first step toward attaining a comprehensive three-dimensional understanding of pre-mRNA splicing.

    Funded by: NHGRI NIH HHS: HG00041; NIGMS NIH HHS: GM53007, GM62580

    RNA (New York, N.Y.) 2002;8;4;426-39

  • PABP1 identified as an arginine methyltransferase substrate using high-density protein arrays.

    Lee J and Bedford MT

    The University of Texas M.D. Anderson Cancer Center, Science Park-Research Division, PO Box 389, Smithville, TX 78957, USA.

    The arginine methyltransferases CARM1 and PRMT1 associate with the p160 family of nuclear hormone receptor coactivators. This association enhances transcriptional activation by nuclear receptors. We describe a method for identifying arginine N-methyltransferase substrates using arrayed high-density protein membranes to perform solid-phase supported enzyme reactions in the presence of the methyl donor S-adenosyl-l-methionine. Using this screen, we identified distinct substrates for CARM1 and PRMT1. All PRMT1 substrates harbor the expected GGRGG methylation motif, whereas the peptide sequence comparisons of the CARM1 substrates revealed no such motif. The predominant CARM1 substrate identified in this screen was PABP1. We mapped the methylated region of this RNA binding molecule in vitro and demonstrate that PABP1 is indeed methylated in vivo. Prior to these findings, the only known substrate for CARM1 was histone H3. We broaden the number of CARM1 targets and suggest a role for CARM1 in regulating transcription/translation.

    Funded by: NIEHS NIH HHS: ES07784, P30 ES007784

    EMBO reports 2002;3;3;268-73

  • Paxillin associates with poly(A)-binding protein 1 at the dense endoplasmic reticulum and the leading edge of migrating cells.

    Woods AJ, Roberts MS, Choudhary J, Barry ST, Mazaki Y, Sabe H, Morley SJ, Critchley DR and Norman JC

    Department of Biochemistry, University of Leicester, University Road, Leicester, LE1 7RH, United Kingdom.

    Using mass spectrometry we have identified proteins which co-immunoprecipitate with paxillin, an adaptor protein implicated in the integrin-mediated signaling pathways of cell motility. A major component of paxillin immunoprecipitates was poly(A)-binding protein 1, a 70-kDa mRNA-binding protein. Poly(A)-binding protein 1 associated with both the alpha and beta isoforms of paxillin, and this was unaffected by RNase treatment consistent with a protein-protein interaction. The NH(2)-terminal region of paxillin (residues 54-313) associated directly with poly(A)-binding protein 1 in cell lysates, and with His-poly(A)-binding protein 1 immobilized in microtiter wells. Binding was specific, saturable and of high affinity (K(d) of approximately 10 nm). Cell fractionation studies showed that at steady state, the bulk of paxillin and poly(A)-binding protein 1 was present in the "dense" polyribosome-associated endoplasmic reticulum. However, inhibition of nuclear export with leptomycin B caused paxillin and poly(A)-binding protein 1 to accumulate in the nucleus, indicating that they shuttle between the nuclear and cytoplasmic compartments. When cells migrate, poly(A)-binding protein 1 colocalized with paxillin-beta at the tips of lamellipodia. Our results suggest a new mechanism whereby a paxillin x poly(A)-binding protein 1 complex facilitates transport of mRNA from the nucleus to sites of protein synthesis at the endoplasmic reticulum and the leading lamella during cell migration.

    The Journal of biological chemistry 2002;277;8;6428-37

  • Protein-protein interaction panel using mouse full-length cDNAs.

    Suzuki H, Fukunishi Y, Kagawa I, Saito R, Oda H, Endo T, Kondo S, Bono H, Okazaki Y and Hayashizaki Y

    Laboratory for Genome Exploration Research Group, RIKEN Genomic Sciences Center, Yokohama 230-0045, Japan.

    We have developed a novel assay system for systematic analysis of protein-protein interactions (PPIs) that is characteristic of a PCR-mediated rapid sample preparation and a high-throughput assay system based on the mammalian two-hybrid method. Using gene-specific primers, we successfully constructed the assay samples by two rounds of PCR with up to 3.6 kb from the first-round PCR fragments. In the assay system, we designed all the steps to be performed by adding only samples, reagents, and cells into 384-well assay plates using two types of semiautomatic multiple dispensers. The system enabled us examine more than 20,000 assay wells per day. We detected 145 interactions in our pilot study using 3500 samples derived from mouse full-length enriched cDNAs. Analysis of the interaction data showed both several significant interaction clusters and predicted functions of a few uncharacterized proteins. In combination with our comprehensive mouse full-length cDNA clone bank covering a large part of the whole genes, our high-throughput assay system will discover many interactions to facilitate understanding of the function of uncharacterized proteins and the molecular mechanism of crucial biological processes, and also enable completion of a rough draft of the entire PPI panel in certain cell types or tissues of mouse within a short time.

    Genome research 2001;11;10;1758-65

  • Dual interactions of the translational repressor Paip2 with poly(A) binding protein.

    Khaleghpour K, Kahvejian A, De Crescenzo G, Roy G, Svitkin YV, Imataka H, O'Connor-McCourt M and Sonenberg N

    Department of Biochemistry and McGill Cancer Center, McGill University, Montréal, Québec, Canada H3G 1Y6.

    The cap structure and the poly(A) tail of eukaryotic mRNAs act synergistically to enhance translation. This effect is mediated by a direct interaction of eukaryotic initiation factor 4G and poly(A) binding protein (PABP), which brings about circularization of the mRNA. Of the two recently identified PABP-interacting proteins, one, Paip1, stimulates translation, and the other, Paip2, which competes with Paip1 for binding to PABP, represses translation. Here we studied the Paip2-PABP interaction. Biacore data and far-Western analysis revealed that Paip2 contains two binding sites for PABP, one encompassing a 16-amino-acid stretch located in the C terminus and a second encompassing a larger central region. PABP also contains two binding regions for Paip2, one located in the RNA recognition motif (RRM) region and the other in the carboxy-terminal region. A two-to-one stoichiometry for binding of Paip2 to PABP with two independent K(d)s of 0.66 and 74 nM was determined. Thus, our data demonstrate that PABP and Paip2 could form a trimeric complex containing one PABP molecule and two Paip2 molecules. Significantly, only the central Paip2 fragment, which binds with high affinity to the PABP RRM region, inhibits PABP binding to poly(A) RNA and translation.

    Molecular and cellular biology 2001;21;15;5200-13

  • Disruption of the interaction of mammalian protein synthesis eukaryotic initiation factor 4B with the poly(A)-binding protein by caspase- and viral protease-mediated cleavages.

    Bushell M, Wood W, Carpenter G, Pain VM, Morley SJ and Clemens MJ

    Department of Biochemistry and Immunology, Cellular and Molecular Sciences Group, St. George's Hospital Medical School, Cranmer Terrace, London SW17 0RE, United Kingdom.

    Eukaryotic initiation factor (eIF) 4B interacts with several components of the initiation pathway and is targeted for cleavage during apoptosis. In a cell-free system, cleavage of eIF4B by caspase-3 coincides with a general inhibition of protein synthetic activity. Affinity chromatography demonstrates that mammalian eIF4B interacts with the poly(A)-binding protein and that a region consisting of the N-terminal 80 amino acids of eIF4B is both necessary and sufficient for such binding. This interaction is lost when eIF4B is cleaved by caspase-3, which removes the N-terminal 45 amino acids. Similarly, the association of eIF4B with the poly(A)-binding protein in vivo is reduced when cells are induced to undergo apoptosis. Cleavage of the poly(A)-binding protein itself, using human rhinovirus 3C protease, also eliminates the interaction with eIF4B. Thus, disruption of the association between mammalian eIF4B and the poly(A)-binding protein can occur during both apoptosis and picornaviral infection and is likely to contribute to the inhibition of translation observed under these conditions.

    The Journal of biological chemistry 2001;276;26;23922-8

  • Human testis expresses a specific poly(A)-binding protein.

    Féral C, Guellaën G and Pawlak A

    Unité INSERM 99, Hôpital Henri Mondor, 94010 Créteil, France.

    In testis mRNA stability and translation initiation are extensively under the control of poly(A)-binding proteins (PABP). Here we have cloned a new human testis-specific PABP (PABP3) of 631 amino acids (70.1 kDa) with 92.5% identical residues to the ubiquitous PABP1. A northern blot of multiple human tissues hybridised with PABP3- and PABP1-specific oligonucleotide probes revealed two PABP3 mRNAs (2.1 and 2.5 kb) detected only in testis, whereas PABP1 mRNA (3.2 kb) was present in all tested tissues. In human adult testis, PABP3 mRNA expression was restricted to round spermatids, whereas PABP1 was expressed in these cells as well as in pachytene spermatocytes. PABP3-specific antibodies identified a protein of 70 kDa in human testis extracts. This protein binds poly(A) with a slightly lower affinity as compared to PABP1. The human PABP3 gene is intronless with a transcription start site 61 nt upstream from the initiation codon. A sequence of 256 bp upstream from the transcription start site drives the promoter activity of PABP3 and its tissue-specific expression. The expression of PABP3 might be a way to bypass PABP1 translational repression and to produce the amount of PABP needed for active mRNA translation in spermatids.

    Nucleic acids research 2001;29;9;1872-83

  • Translational repression by a novel partner of human poly(A) binding protein, Paip2.

    Khaleghpour K, Svitkin YV, Craig AW, DeMaria CT, Deo RC, Burley SK and Sonenberg N

    Department of Biochemistry, McGill Cancer Center, McGill University, Montreal, Quebec, Canada H3G 1Y6.

    The eukaryotic mRNA 3' poly(A) tail acts synergistically with the 5' cap structure to enhance translation. This effect is mediated by a bridging complex, composed of the poly(A) binding protein (PABP), eIF4G, and the cap binding protein, eIF4E. PABP-interacting protein 1 (Paip1) is another factor that interacts with PABP to coactivate translation. Here, we describe a novel human PABP-interacting protein (Paip2), which acts as a repressor of translation both in vitro and in vivo. Paip2 preferentially inhibits translation of a poly(A)-containing mRNA, but has no effect on the translation of hepatitis C virus mRNA, which is cap- and eIF4G-independent. Paip2 decreases the affinity of PABP for polyadenylate RNA, and disrupts the repeating structure of poly(A) ribonucleoprotein. Furthermore, Paip2 competes with Paip1 for PABP binding. Thus, Paip2 inhibits translation by interdicting PABP function.

    Funded by: NCI NIH HHS: 1F32CA74494-01A1; NIGMS NIH HHS: GM1262

    Molecular cell 2001;7;1;205-16

  • A mechanism for translationally coupled mRNA turnover: interaction between the poly(A) tail and a c-fos RNA coding determinant via a protein complex.

    Grosset C, Chen CY, Xu N, Sonenberg N, Jacquemin-Sablon H and Shyu AB

    Department of Biochemistry and Molecular Biology, The University of Texas Houston Medical School 77030, USA.

    mRNA turnover mediated by the major protein-coding-region determinant of instability (mCRD) of the c-fos proto-oncogene transcript illustrates a functional interplay between mRNA turnover and translation. We show that the function of mCRD depends on its distance from the poly(A) tail. Five mCRD-associated proteins were identified: Unr, a purine-rich RNA binding protein; PABP, a poly(A) binding protein; PAIP-1, a poly(A) binding protein interacting protein; hnRNP D, an AU-rich element binding protein; and NSAP1, an hnRNP R-like protein. These proteins form a multiprotein complex. Overexpression of these proteins stabilized mCRD-containing mRNA by impeding deadenylation. We propose that a bridging complex forms between the poly(A) tail and the mCRD and ribosome transit disrupts or reorganizes the complex, leading to rapid RNA deadenylation and decay.

    Funded by: NIGMS NIH HHS: GM 46454, GM 59211, R01 GM046454, R01 GM059211

    Cell 2000;103;1;29-40

  • Chromosomal localization of three human poly(A)-binding protein genes and four related pseudogenes.

    Féral C, Mattéi MG, Pawlak A and Guellaën G

    Unité INSERM U99, Hôpital H Mondor, Créteil, France.

    In humans, the poly(A)-binding proteins (PABPs) comprise a small nuclear isoform and a conserved gene family that displays at least three functional proteins: PABP1, inducible PABP (iPABP), and PABP3, plus four pseudogenes (1, 2, 3, and PABP4). In situ hybridization of PABP3 cDNA as the probe on metaphasic chromosomes have revealed five possible loci for this gene family at 2q21-q22, 13q11-q12, 12q13.3-q15, 8q22, and 3q24-q25. Amplifications of specific DNA fragments from a human-rodent somatic cell hybrid panel have allowed us to associate PABP1 and PABP3 with 8q22 and 13q11-q12, respectively. The iPABP gene has been assigned to chromosome 1. This result, compared with radiation hybrid database information, strengthens the location of this gene to 1p32-p36. The pseudogenes PABP4, 1, and 2 have been assigned to chromosomes 15, 4, and 14, respectively. Three loci detected on chromosome spreads are not associated with any amplified fragment. They might represent other related PABP genes not yet identified.

    Human genetics 1999;105;4;347-53

  • Recognition of polyadenylate RNA by the poly(A)-binding protein.

    Deo RC, Bonanno JB, Sonenberg N and Burley SK

    Laboratories of Molecular Biophysics, The Rockefeller University, New York, New York 10021, USA.

    The cocrystal structure of human poly(A)-binding protein (PABP) has been determined at 2.6 A resolution. PABP recognizes the 3' mRNA poly(A) tail and plays critical roles in eukaryotic translation initiation and mRNA stabilization/degradation. The minimal PABP used in this study consists of the N-terminal two RRM-type RNA-binding domains connected by a short linker (RRM1/2). These two RRMs form a continuous RNA-binding trough, lined by an antiparallel beta sheet backed by four alpha helices. The polyadenylate RNA adopts an extended conformation running the length of the molecular trough. Adenine recognition is primarily mediated by contacts with conserved residues found in the RNP motifs of the two RRMs. The convex dorsum of RRM1/2 displays a phylogenetically conserved hydrophobic/acidic portion, which may interact with translation initiation factors and regulatory proteins.

    Cell 1999;98;6;835-45

  • An mRNA stability complex functions with poly(A)-binding protein to stabilize mRNA in vitro.

    Wang Z, Day N, Trifillis P and Kiledjian M

    Department of Cell Biology and Neuroscience, Rutgers University, Piscataway, New Jersey 08854-8082, USA.

    The stable globin mRNAs provide an ideal system for studying the mechanism governing mammalian mRNA turnover. alpha-Globin mRNA stability is dictated by sequences in the 3' untranslated region (3'UTR) which form a specific ribonucleoprotein complex (alpha-complex) whose presence correlates with mRNA stability. One of the major protein components within this complex is a family of two polycytidylate-binding proteins, alphaCP1 and alphaCP2. Using an in vitro-transcribed and polyadenylated alpha-globin 3'UTR, we have devised an in vitro mRNA decay assay which reproduces the alpha-complex-dependent mRNA stability observed in cells. Incubation of the RNA with erythroleukemia K562 cytosolic extract results in deadenylation with distinct intermediates containing a periodicity of approximately 30 nucleotides, which is consistent with the binding of poly(A)-binding protein (PABP) monomers. Disruption of the alpha-complex by sequestration of alphaCP1 and alphaCP2 enhances deadenylation and decay of the mRNA, while reconstitution of the alpha-complex stabilizes the mRNA. Similarly, PABP is also essential for the stability of mRNA in vitro, since rapid deadenylation resulted upon its depletion. An RNA-dependent interaction between alphaCP1 and alphaCP2 with PABP suggests that the alpha-complex can directly interact with PABP. Therefore, the alpha-complex is an mRNA stability complex in vitro which could function at least in part by interacting with PABP.

    Funded by: NIDDK NIH HHS: DK51611, R01 DK051611

    Molecular and cellular biology 1999;19;7;4552-60

  • The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3'-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein.

    Hoshino S, Imai M, Kobayashi T, Uchida N and Katada T

    Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033, Japan. hoshino@mol.f.u-tokyo.ac.jp

    The mammalian GTP-binding protein GSPT, whose carboxyl-terminal sequence is homologous to the eukaryotic elongation factor EF1alpha, binds to the polypeptide chain releasing factor eRF1 to function as eRF3 in the translation termination. The amino-terminal domain of GSPT was, however, not required for the binding. Search for other GSPT-binding proteins in yeast two-hybrid screening system resulted in the identification of a cDNA encoding polyadenylate-binding protein (PABP), whose amino terminus is associating with the poly(A) tail of mRNAs presumably for their stabilization. The interaction appeared to be mediated through the carboxyl-terminal domain of PABP and the amino-terminal region of GSPT. Interestingly, multimerization of PABP with poly(A), which is ascribed to the action of its carboxyl-terminal domain, was completely inhibited by the interaction with the amino-terminal domain of GSPT. These results indicate that GSPT/eRF3 may play important roles not only in the termination of protein synthesis but also in the regulation of mRNA stability. Thus, the present study is the first report showing that GSPT/eRF3 carries the translation termination signal to 3'-poly(A) tail ubiquitously present in eukaryotic mRNAs.

    The Journal of biological chemistry 1999;274;24;16677-80

  • Control of mRNA decay by heat shock-ubiquitin-proteasome pathway.

    Laroia G, Cuesta R, Brewer G and Schneider RJ

    Department of Microbiology and Biochemistry, New York University School of Medicine, New York, NY 10016, USA.

    Cytokine and proto-oncogene messenger RNAs (mRNAs) are rapidly degraded through AU-rich elements in the 3' untranslated region. Rapid decay involves AU-rich binding protein AUF1, which complexes with heat shock proteins hsc70-hsp70, translation initiation factor eIF4G, and poly(A) binding protein. AU-rich mRNA decay is associated with displacement of eIF4G from AUF1, ubiquitination of AUF1, and degradation of AUF1 by proteasomes. Induction of hsp70 by heat shock, down-regulation of the ubiquitin-proteasome network, or inactivation of ubiquitinating enzyme E1 all result in hsp70 sequestration of AUF1 in the perinucleus-nucleus, and all three processes block decay of AU-rich mRNAs and AUF1 protein. These results link the rapid degradation of cytokine mRNAs to the ubiquitin-proteasome pathway.

    Funded by: NCI NIH HHS: CA42357, CA52443

    Science (New York, N.Y.) 1999;284;5413;499-502

  • The expression of poly(A)-binding protein gene is translationally regulated in a growth-dependent fashion through a 5'-terminal oligopyrimidine tract motif.

    Hornstein E, Git A, Braunstein I, Avni D and Meyuhas O

    Department of Biochemistry, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel.

    Poly(A)-binding protein (PABP) is an important regulator of gene expression that has been implicated in control of translation initiation. Here we report the isolation and the initial structural and functional characterization of the human PABP gene. Delineation of the promoter region revealed that it directs the initiation of transcription at consecutive C residues within a stretch of pyrimidines. A study of the translational behavior of the corresponding mRNA demonstrates that it is translationally repressed upon growth arrest of cultured mouse fibroblasts and translationally activated in regenerating rat liver. Furthermore, transfection experiments show that the first 32 nucleotides of PABP mRNA are sufficient to confer growth-dependent translational control on a heterologous mRNA. Substitution of the C residue at the cap site by purines abolishes the translational control of the chimeric mRNA. These features have established PABP mRNA as a new member of the terminal oligopyrimidine tract mRNA family. Members of this family are known to encode for components of the translational apparatus and to contain an oligopyrimidine tract at the 5' terminus (5'TOP). This motif mediates their translational control in a growth-dependent manner.

    The Journal of biological chemistry 1999;274;3;1708-14

  • A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation.

    Imataka H, Gradi A and Sonenberg N

    Department of Biochemistry and McGill Cancer Centre, McGill University, Drummond Street 3655, Montreal, Quebec, Canada H3G 1Y6.

    Most eukaryotic mRNAs possess a 5' cap and a 3' poly(A) tail, both of which are required for efficient translation. In yeast and plants, binding of eIF4G to poly(A)-binding protein (PABP) was implicated in poly(A)-dependent translation. In mammals, however, there has been no evidence that eIF4G binds PABP. Using 5' rapid amplification of cDNA, we have extended the known human eIF4GI open reading frame from the N-terminus by 156 amino acids. Co-immunoprecipitation experiments showed that the extended eIF4GI binds PABP, while the N-terminally truncated original eIF4GI cannot. Deletion analysis identified a 29 amino acid sequence in the new N-terminal region as the PABP-binding site. The 29 amino acid stretch is almost identical in eIF4GI and eIF4GII, and the full-length eIF4GII also binds PABP. As previously shown for yeast, human eIF4G binds to a fragment composed of RRM1 and RRM2 of PABP. In an in vitro translation system, an N-terminal fragment which includes the PABP-binding site inhibits poly(A)-dependent translation, but has no effect on translation of a deadenylated mRNA. These results indicate that, in addition to a recently identified mammalian PABP-binding protein, PAIP-1, eIF4G binds PABP and probably functions in poly(A)-dependent translation in mammalian cells.

    The EMBO journal 1998;17;24;7480-9

  • The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm.

    Afonina E, Stauber R and Pavlakis GN

    Human Retrovirus Section, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702-1201, USA.

    We have studied the intracellular localization of poly(A)-binding protein 1 (PABP1) by indirect immunofluorescence as well as by tagging with the green fluorescent protein (GFP) in living cells. We show that PABP1 is able to enter the nucleus. Accumulation of PABP1 in the nuclei was observed upon transcription inhibition, suggesting that active transcription is required for PABP1 export. The nuclear import of PABP1 is an energy-dependent process since PABP1 fails to enter the nucleus upon ATP depletion and at low temperature. Transfection of PABP1 or PABP1-GFP resulted in heterogeneity of intracellular distribution of the protein. In the low expressing cells, PABP1 was localized in the cytoplasm, whereas in the high expressors, we observed accumulation of the protein in the nucleus. Nuclear PABP1 observed either after overexpression or after transcription inhibition was found in speckles and colocalized with splicing factor SC35. The ability of PABP1 to shuttle between nucleus and cytoplasm was also shown by heterokaryon formation upon cell fusion. Deletion mutagenesis showed that the minimal part of PABP1 retaining the ability to shuttle consists of the first two RNA-binding domains. This mutant interacted with poly(A) RNA with high affinity and accumulated in the nucleus. Deletion mutants exhibiting reduced RNA binding affinity did not accumulate in the nucleus. PABP1 has been proposed to participate at various steps of mRNA utilization. Our results suggest involvement of PABP1 in nuclear events associated with the formation and transport of mRNP to the cytoplasm and identify a new trafficking pattern for RNA-binding proteins.

    The Journal of biological chemistry 1998;273;21;13015-21

  • Interaction of polyadenylate-binding protein with the eIF4G homologue PAIP enhances translation.

    Craig AW, Haghighat A, Yu AT and Sonenberg N

    Department of Biochemistry, McGill University, Montreal, Quebec, Canada.

    In the initiation of translation in eukaryotes, binding of the small ribosomal subunit to the messenger RNA results from recognition of the 5' cap structure (m7GpppX) of the mRNA by the cap-binding complex eIF4F. eIF4F is itself a three-subunit complex comprising the cap-binding protein eIF4E, eIF4A, an ATP-dependent RNA helicase, and eIF4G, which interacts with both eIF4A and eIF4E and enhances cap binding by eIF4E. The mRNA 3' polyadenylate tail and the associated poly(A)-binding protein (PABP) also regulate translational initiation, probably by interacting with the 5' end of the mRNA. In yeast and plants, PABP interacts with eIF4G but no such interaction has been reported in mammalian cells. Here, we describe a new human PABP-interacting protein, PAIP-I, whose sequence is similar to the central portion of eIF4G and which interacts with eIF4A. Overexpression of PAIP-1 in COS-7 cells stimulates translation, perhaps by providing a physical link between the mRNA termini.

    Nature 1998;392;6675;520-3

  • Role of polyadenylation in nucleocytoplasmic transport of mRNA.

    Huang Y and Carmichael GG

    Department of Microbiology, University of Connecticut Health Center, Farmington, 06030, USA.

    To examine the role of polyadenylation in the nuclear export of mRNA, we have replaced the poly(A) signal in a Rev-responsive human immunodeficiency virus type 1-based reporter gene with a cis-acting hammerhead ribozyme. Transcripts from this gene thus acquire a 3' terminus by cis-ribozyme cleavage rather than by polyadenylation. The nuclear and cytoplasmic distribution of transcripts was investigated using transient gene expression and quantitative RNase protection assays. In the absence of Rev, a basal level of polyadenylated unspliced mRNA transcribed from a poly(A) signal-containing control reporter gene was detected in the cytoplasm of transfected COS7 cells. However, cytoplasmic ribozyme-cleaved unspliced RNA was only barely detectable. The nuclear/cytoplasmic (n/c) ratio of polyadenylated RNAs was 3.8, while the n/c ratio for ribozyme cis-cleaved RNAs was 33. The cytoplasmic localization of the polyadenylated unspliced mRNA was enhanced about 10-fold in the presence of Rev and the Rev-responsive element. In marked contrast to this, ribozyme cleaved RNA accumulated almost exclusively (n/c ratio of 28) in the nucleus in the presence of Rev. Actinomycin D time course analysis suggested that the low levels of the cytoplasmic ribozyme-cleaved RNAs in both the presence and absence of Rev were due to serve export deficiency of ribozyme-cleaved RNA. Finally, by inserting a 90-nucleotide poly(A) stretch directly upstream of the ribozyme cassette, we have demonstrated that a long stretch of poly(A) near the 3' end of a ribozyme-cleaved transcript is not sufficient for directing mRNA export. Taken together, these results suggest that polyadenylation is required for the nucleocytoplasmic transport of mRNA and that Rev interaction with the Rev-responsive element cannot bypass this requirement.

    Funded by: NCI NIH HHS: CA45382, R01 CA045382

    Molecular and cellular biology 1996;16;4;1534-42

  • Human immunodeficiency virus type 1 Rev is required in vivo for binding of poly(A)-binding protein to Rev-dependent RNAs.

    Campbell LH, Borg KT, Haines JK, Moon RT, Schoenberg DR and Arrigo SJ

    Department of Microbiology and Immunology, Medical University of South Carolina, Charleston 29425-2230.

    In the absence of Rev or the Rev-responsive element, the Rev-dependent human immunodeficiency virus type 1 (HIV-1) RNAs do not behave as mRNAs; rather, they exhibit nuclear defects in splicing and/or nuclear export and cytoplasmic defects in stability and translation. A translational initiation factor, eIF-5A, has recently been shown to bind specifically to the Rev activation domain. As the binding of poly(A)-binding protein 1 (PAB1) to the poly(A) tail of mRNAs is involved in both the stability and translation of cytoplasmic mRNAs, we investigated whether Rev might influence the association of PAB1 with cytoplasmic HIV-1 RNAs. Antibodies were generated against PAB1. We used these antibodies in an immunoprecipitation assay to detect specific binding of PAB1 to cytoplasmic mRNAs. We found that in the presence of Rev, PAB1 was associated with Rev-dependent and Rev-independent RNAs in the cytoplasm of transfected cells. However, in the absence of functional Rev, we found little or no PAB1 associated with Rev-dependent RNAs. These RNAs were capable of binding PAB1 in vitro. These results demonstrate that HIV-1 RNAs are defective in PAB1 association in the absence of Rev.

    Funded by: NIAID NIH HHS: AI32415

    Journal of virology 1994;68;9;5433-8

  • The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity.

    Görlach M, Burd CG and Dreyfuss G

    Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, Philadelphia 19104-6148.

    The poly(A)-binding protein (PABP) binds to the messenger (mRNA) 3'-poly(A) tail found on most eukaryotic mRNAs and together with the poly(A) tail has been implicated in governing the stability and the translation of mRNA. In order to further understand the role of the PABP in these processes, we have undertaken a detailed analysis of the cellular localization, the abundance, and the RNA-binding properties of the human PABP (hPABP). We raised monoclonal antibodies against the 70-kDa hPABP and confocal immunofluorescence microscopy with these antibodies reveals that it is localized exclusively to the cytoplasm. The hPABP exhibits a very low turnover rate in these cells and quantitative immunoblotting experiments demonstrated that growing HeLa cells contain a surprisingly high number of approximately 8 x 10(6) PABP molecules per cell, which corresponds to an intracellular concentration of about 4 microM. In an in vitro selection/amplification assay from random sequence oligonucleotide pools the hPABP selects oligo(rA)-rich sequences and it binds oligo(rA)25 with an apparent Kd of 7 nM. The hPABP binds to unrelated RNA sequences with an about 100-fold lower affinity (Kd > or = 0.5 microM). The abundance of the hPABP indicates that there is an approximately three-fold excess of the protein over binding sites on cytoplasmic poly(A). This excess and the high concentration of the hPABP, which is three orders of magnitude above its Kd for oligo(rA)25, suggest that the hPABP may bind to additional, lower affinity binding sites in vivo.

    Experimental cell research 1994;211;2;400-7

  • Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    Grange T, de Sa CM, Oddos J and Pictet R

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis.

    Nucleic acids research 1987;15;12;4771-87

Gene lists (6)

Gene List Source Species Name Description Gene count
L00000009 G2C Homo sapiens Human PSD Human orthologues of mouse PSD adapted from Collins et al (2006) 1080
L00000016 G2C Homo sapiens Human PSP Human orthologues of mouse PSP adapted from Collins et al (2006) 1121
L00000059 G2C Homo sapiens BAYES-COLLINS-HUMAN-PSD-CONSENSUS Human cortex PSD consensus 748
L00000061 G2C Homo sapiens BAYES-COLLINS-MOUSE-PSD-CONSENSUS Mouse cortex PSD consensus (ortho) 984
L00000069 G2C Homo sapiens BAYES-COLLINS-HUMAN-PSD-FULL Human cortex biopsy PSD full list 1461
L00000071 G2C Homo sapiens BAYES-COLLINS-MOUSE-PSD-FULL Mouse cortex PSD full list (ortho) 1556
© G2C 2014. The Genes to Cognition Programme received funding from The Wellcome Trust and the EU FP7 Framework Programmes:
EUROSPIN (FP7-HEALTH-241498), SynSys (FP7-HEALTH-242167) and GENCODYS (FP7-HEALTH-241995).

Cookies Policy | Terms and Conditions. This site is hosted by Edinburgh University and the Genes to Cognition Programme.