G2Cdb::Gene report

Gene id
G00001355
Gene symbol
C1QBP (HGNC)
Species
Homo sapiens
Description
complement component 1, q subcomponent binding protein
Orthologue
G00000106 (Mus musculus)

Databases (7)

Gene
ENSG00000108561 (Ensembl human gene)
708 (Entrez Gene)
443 (G2Cdb plasticity & disease)
C1QBP (GeneCards)
Literature
601269 (OMIM)
Marker Symbol
HGNC:1243 (HGNC)
Protein Sequence
Q07021 (UniProt)

Synonyms (4)

  • SF2p32
  • gC1Q-R
  • gC1qR
  • p32

Literature (63)

Pubmed - other

  • Role of the receptor for the globular domain of C1q protein in the pathogenesis of hepatitis C virus-related cryoglobulin vasc 3e1 ular damage.

    Sansonno D, Tucci FA, Ghebrehiwet B, Lauletta G, Peerschke EI, Conteduca V, Russi S, Gatti P, Sansonno L and Dammacco F

    Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Policlinico, Piazza Giulio Cesare 11, 70124 Bari, Italy. d.sansonno@dimo.uniba.it

    Mixed cryoglobulinemia (MC) is a lymphoproliferative disorder observed in approximately 10 to 15% of hepatitis C virus (HCV)-infected patients. Circulating, nonenveloped HCV core protein, which has been detected in cryoprecipitable immune complexes, interacts with immunocytes through the receptor for the globular domain of C1q protein (gC1q-R). In this study, we have evaluated circulating gC1q-R levels in chronically HCV-infected patients, with and without MC. These levels were significantly higher in MC patients than in those without MC and in healthy controls and paralleled specific mRNA expression in PBL. Soluble gC1q-R circulates as a complexed form containing both C1q and HCV core proteins. Higher serum gC1q f1b -R levels negatively correlated with circulating concentrations of the C4d fragment. The presence of sequestered C4d in the vascular bed of skin biopsies from MC patients was indicative of in situ complement activation. In vitro studies showed that release of soluble gC1q-R is regulated by HCV core-mediated inhibition of cell proliferation. Our results indicate that up-regulation of gC1q-R expression is a distinctive feature of MC, and that dysregulated shedding of C1q-R molecules contributes to vascular cryoglobulin-induced damage via the classic complement-mediated pathway.

    Funded by: NHLBI NIH HHS: HL67211, R01 HL067211; NIAID NIH HHS: AI 060866, R01 AI060866, R01 AI060866-04, R56 AI060866

    Journal of immunology (Baltimore, Md. : 1950) 2009;183;9;6013-20

  • The metastasis efficiency modifier ribosomal RNA processing 1 homolog B (RRP1B) is a chromatin-associated factor.

    Crawford NP, Yang H, Mattaini KR and Hunter KW

    Laboratory of Cancer Biology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA.

    There is accumulating evidence for a role of germ line variation in breast cancer metastasis. We have recently identified a novel metastasis susceptibility gene, Rrp1b (ribosomal RNA processing 1 homolog B). Overexpression of Rrp1b in a mouse mammary tumor cell line induces a gene expression signature that predicts survival in breast cancer. Here we extend the analysis of RRP1B function by demonstrating that the Rrp1b activation gene expression signature accurately predicted the outcome in three of four publicly available breast carcinoma gene expression data sets. In addition, we provide insights into the mechanism of RRP1B. Tandem affinity purification demonstrated that RRP1B physically interacts with many nucleosome binding factors, including histone H1X, poly(ADP-ribose) polymerase 1, TRIM28 (tripartite motif-containing 28), and CSDA (cold shock domain protein A). Co-immunofluorescence and co-immunoprecipitation confirmed these interactions and also interactions with heterochromatin protein-1alpha and acetyl-histone H4 lysine 5. Finally, we investigated the effects of ectopic expression of an RRP1B allelic variant previously associated with improved survival in breast cancer. Gene expression analyses demonstrate that, compared with ectopic expression of wild type RRP1B in HeLa cells, the variant RRP1B differentially modulates various transcription factors controlled by TRIM28 and CSDA. These data suggest that RRP1B, a tumor progression and metastasis susceptibility candidate gene, is potentially a dynamic modulator of transcription and chromatin structure.

    Funded by: Intramural NIH HHS

    The Journal of biological chemistry 2009;284;42;28660-73

  • Increased expression of hyaluronic acid binding protein 1 is correlated with poor prognosis in patients with breast cancer.

    Chen YB, Jiang CT, Zhang GQ, Wang JS and Pang D

    Department of Breast Surgery, The Affiliated Tumor Hospital of Harbin Medical University, Harbin, PR China.

    Hyaluronic acid binding protein 1 (HABP1), a family of proteins interacting with hyaluronan (HA), had been associated with cell adhesion and tumor invasion. The aim of this study was to investigate the correlation between clinicopathologic factors and patient survival time with the expression of HABP1 in breast cancer patients.

    Methods: Expression of HABP1 mRNA and protein were detected with real-time quantitative PCR and immunohistochemical staining in 63 breast cancer and non-cancerous matched tissues.

    Results: The mRNA expression level of HABP1 was unrelated to the patient's age, tumor size, histological grade, TNM stage. However, it proved to be positively related to axillary nodes metastasis (P = 0.008). Furthermore, it was shown that the survival rate of patients with low HABP1 expression was significantly higher than that of patients with high HABP1 expression (P = 0.025). Multivariate analysis revealed that HABP1 mRNA expression level was a significant factor for predicting prognosis (P = 0.022). The immunohistochemistry results showed that the expression level of HABP1 in breast cancer cells was higher than that in normal breast cells.

    Conclusion: HABP1 might be an independent predictive factor for breast cancer prognosis and up-regulation of HABP1 might play an important role in the metastasis of breast cancer.

    Journal of surgical oncology 2009;100;5;382-6

  • Frequency of gC1qR+CD4+ T cells increases during acute hepatitis C virus infection and remains elevated in patients with chronic infection.

    Cummings KL, Rosen HR and Hahn YS

    Beirne Carter Center for Immunology Research and Department of Microbiology, University of Virginia, Charlottesville, VA 22908, USA.

    CD4+ T cell responses are impaired in chronic HCV infection. To determine factor(s) involved in CD4+ T cell dysregulation, we examined the effect of extracellular core on the alteration of CD4+ T cell responses and the cell surface level of core-binding protein, gC1qR on CD4+ T cells from acute HCV patients with resolved and chronic infection. During the acute phase of infection, the frequency of gC1qR+CD4+ T cells increased in both resolved and chronic HCV infection compared to healthy controls. Notably, 6 months later, the frequency of gC1qR+CD4+ T cells maintained elevated in chronic patients compared to that in resolved patients. In addition, TCR stimulation increased the frequency of gC1qR+CD4+ T cells, resulting in core-induced inhibition of T cell responses in both resolved and chronic patients. These results suggest that HCV infection expands gC1qR+CD4+ T cells, which increase the susceptibility to core-mediated immune dysregulation and facilitate the establishment of HCV persistency.

    Funded by: NIAID NIH HHS: 5T32AI10749608, R01 AI057591, R01 AI057591-05, U19 AI066328, U19 AI066328-040003, U19AI066328; NIDDK NIH HHS: P30 DK067629, R01 DK060590, R01 DK066754

    Clinical immunology (Orlando, Fla.) 2009;132;3;401-11

  • Evidence for inhibitory interaction of hyaluronan-binding protein 1 (HABP1/p32/gC1qR) with Streptococcus pneumoniae hyaluronidase.

    Yadav G, Prasad RL, Jha BK, Rai V, Bhakuni V and Datta K

    Computational Biology Laboratory, National Institute for Plant Genome Research, Aruna Asaf Ali Marg, New Delhi 110067, India. gy@nipgr.res.in

    Bacterial hyaluronan lyase enzymes are the major virulence factors that enable greater microbial ingress by cleaving hyaluronan (HA) polymers present predominantly in extracellular space of vertebrates. Based on the premise that effective inhibitors may bind to and stabilize HA thereby protecting it from degradation, here we investigated inhibitory activity of human hyaluronan-binding protein 1 (HABP1) on bacterial hyaluronidase because it is highly specific to HA and localized on the cell surface. Biochemical characterization revealed that HABP1 is a competitive inhibitor of Streptococcus pneumoniae hyaluronate lyase (SpnHL) with an IC50 value of 22 microm. This is thus the first report of an endogenous protein inhibitor that may be used during natural antibacterial defense. Our findings also support a novel multipronged mechanism for the high efficacy of HABP1-mediated inhibition based on structural modeling of enzyme, substrate, and inhibitor. Evidence from docking simulations and contact interface interactions showed that the inherent charge asymmetry of HABP1 plays a key role in the inhibitory activity. This novel role of HABP1 may pave the way for peptide inhibitors as alternatives to synthetic chemicals in antibacterial research.

    The Journal of biological chemistry 2009;284;6;3897-905

  • Inhibition of RIG-I and MDA5-dependent antiviral response by gC1qR at mitochondria.

    Xu L, Xiao N, Liu F, Ren H and Gu J

    National Key Laboratory of Protein Engineering and Plant Gene Engineering, College of Life Sciences, Peking University, Beijing, China.

    gC1qR is one of the C1q receptors implicated in the regulation of innate and adaptive immunity. We found that gC1qR inhibits RIG-I and MDA5-dependent antiviral signaling. Double stranded RNA and virus trigger the translocation of gC1qR to the mitochondrial outer membrane leading to the interaction of gC1qR with the RIG-I and MDA5 adaptor, VISA/MAVS/IPS-1/Cardif. The interaction of gC1qR with VISA/MAVS/IPS-1/Cardif at mitochondria results in the disruption of RIG-I and MDA5 signaling and the promotion of virus replication. Knockdown of endogenous gC1qR enhances RIG-I-dependent antiviral signaling, and augments the inhibition of virus proliferation. Therefore, gC1qR is a physiological inhibitor of the RIG-I and MDA5-mediated antiviral signaling pathway. These data uncover a new viral mechanism used to negatively control antiviral signaling in host cells.

    Proceedings of the National Academy of Sciences of the United States of America 2009;106;5;1530-5

  • Persisting mixed cryoglobulinemia in Chikungunya infection.

    Oliver M, Grandadam M, Marimoutou C, Rogier C, Botelho-Nevers E, Tolou H, Moalic JL, Kraemer P, Morillon M, Morand JJ, Jeandel P, Parola P and Simon F

    Laboratoire de Biochimie, Hôpital d'Instruction des Armées Laveran, Marseille, France.

    Background: Chikungunya virus (CHIKV), an arbovirus, is responsible for a two-stage disabling disease, consisting of an acute febrile polyarthritis for the first 10 days, frequently followed by chronic rheumatisms, sometimes lasting for years. Up to now, the pathophysiology of the chronic stage has been elusive. Considering the existence of occasional peripheral vascular disorders and some unexpected seronegativity during the chronic stage of the disease, we hypothesized the role of cryoglobulins.

    Methods: From April 2005 to May 2007, all travelers with suspected CHIKV infection were prospectively recorded in our hospital department. Demographic, clinical and laboratory findings (anti-CHIKV IgM and IgG, cryoglobulin) were registered at the first consultation or hospitalization and during follow-up.

    Results: Among the 66 travelers with clinical suspicion of CHIKV infection, 51 presented anti-CHIKV IgM. There were 45 positive with the serological assay tested at room temperature, and six more, which first tested negative when sera were kept at 4 degrees C until analysis, became positive after a 2-hour incubation of the sera at 37 degrees C. Forty-eight of the 51 CHIKV-seropositive patients were screened for cryoglobulinemia; 94% were positive at least once during their follow-up. Over 90% of the CHIKV-infected patients had concomitant arthralgias and cryoglobulinemia. Cryoglobulin prevalence and level drop with time as patients recover, spontaneously or after short-term corticotherapy. In some patients cryoglobulins remained positive after 1 year.

    Conclusion: Prevalence of mixed cryoglobulinemia was high in CHIKV-infected travelers with long-lasting symptoms. No significant association between cryoglobulinemia and clinical manifestations could be evidenced. The exact prognostic value of cryoglobulin levels has yet to be determined. Responsibility of cryoglobulinemia was suspected in unexpected false negativity of serological assays at room temperature, leading us to recommend performing serology on pre-warmed sera.

    PLoS neglected tropical diseases 2009;3;2;e374

  • Human p32 is a novel FOXC1-interacting protein that regulates FOXC1 transcriptional activity in ocular cells.

    Huang L, Chi J, Berry FB, Footz TK, Sharp MW and Walter MA

    Department of Medical Genetics, University of Alberta, Edmonton, Alberta, Canada.

    Purpose: Mutations in the human forkhead box C1 gene (FOXC1) cause Axenfeld-Rieger (AR) malformations, often leading to glaucoma. Understanding the function of FOXC1 necessitates characterizing the proteins that interact with FOXC1. This study was undertaken to isolate FOXC1-interacting proteins and determine their effects on FOXC1.

    Methods: To identify FOXC1-interacting proteins, a human trabecular meshwork (HTM) yeast two-hybrid (Y2H) cDNA library was screened. The interaction and colocalization between FOXC1 and its putative protein partner were confirmed by Ni(2+) pull-down assays, immunoprecipitation, and immunofluorescence, respectively. The electrophoretic mobility shift assay (EMSA) was used to study the effect of the interacting protein on FOXC1 DNA-binding ability. Dual luciferase assays using FOXC1 reporter plasmids in HTM cells were performed to determine the effect of the interaction on FOXC1 transcription activity.

    Results: The human p32 protein was isolated as a putative FOXC1-interacting protein from a Y2H screen. The interaction of FOXC1 with p32 was confirmed by Ni-pull-down assays and immunoprecipitation. Although p32 is predominantly cytoplasmic, the portion of p32 that is within the nucleus colocalizes with FOXC1. The FOXC1 forkhead domain (FHD) was identified as the p32 interaction domain. p32 significantly inhibited FOXC1-mediated transcription activation in a dose-dependent manner but did not affect FOXC1 DNA-binding ability. Of interest, a FOXC1 mutation F112S displayed an impaired interaction with p32.

    Conclusions: In the study, the human p32 protein as a novel regulator of FOXC1-mediated transcription activation. Failure of p32 to interact with FOXC1 containing the disease-causing F112S mutation indicates that impaired protein interaction may be a disease mechanism for AR malformations.

    Investigative ophthalmology & visual science 2008;49;12;5243-9

  • Mitochondrial/cell-surface protein p32/gC1qR as a molecular target in tumor cells and tumor stroma.

    Fogal V, Zhang L, Krajewski S and Ruoslahti E

    Cancer Research Center, Burnham Institute for Medical Research, La Jolla, California, USA.

    A tumor homing peptide, LyP-1, selectively binds to tumor-associated lymphatic vessels and tumor cells in certain tumors and exhibits an antitumor effect. Here, we show that the protein known as p32 or gC1q receptor is the receptor for LyP-1. Various human tumor cell lines were positive for p32 expression in culture, and the expression was increased in xenograft tumors grown from the positive cell lines. Fluorescence-activated cell sorting analyses with anti-p32 antibodies showed that p3 75d 2-positive cell lines expressed p32 at the cell surface. These cells bound and internalized LyP-1 peptide in proportion to the cell-surface expression level, which correlated with malignancy rather than total p32 expression in the cells. Like the LyP-1 peptide, p32 antibodies highlighted hypoxic areas in tumors, where they bound to both tumor cells and cells that expressed macrophage/myeloid cell markers and often seemed to be incorporated into the walls of tumor lymphatics. Significant p32 expression was common in human cancers and the p32 levels were often greatly elevated compared with the corresponding normal tissue. These results establish p32, particularly its cell-surface-expressed form, as a new marker of tumor cells and tumor-associated macrophages/myeloid cells in hypoxic/metabolically deprived areas of tumors. Its unique localization in tumors and its relative tumor specificity may make p32 a useful target in tumor diagnosis and therapy.

    Funded by: NCI NIH HHS: CA 30199, CA104898, CA115410, P01 CA104898, P01 CA104898-030002, P30 CA030199, P30 CA030199-229008, R01 CA115410, R01 CA115410-04

    Cancer research 2008;68;17;7210-8

  • Differential isoform expression and interaction with the P32 regulatory protein controls the subcellular localization of the splicing factor U2AF26.

    Heyd F, Carmo-Fonseca M and Möröy T

    Institut de Recherches Cliniques de Montréal, Montréal, Quebec H2W 1R7, Canada.

    The U2 auxiliary factor (U2AF) is an integral part of the spliceosome that is important for the recognition of the 3' splice site. U2AF consists of a large and a small subunit, the prototypes of which are U2AF65 and U2AF35. Recent evidence suggests that several homologs of both U2AF subunits exist that are able to regulate alternative splicing. Here we have investigated the expression, intracellular localization, and nucleo-cytoplasmic shuttling of one homolog of the small U2AF subunit, U2AF26, and a splice variant lacking exon 7, U2AF26DeltaE7. In contrast to the nuclear U2AF26, which displays active nucleo-cytoplasmic shuttling, U2AF26DeltaE7 is localized in the cytoplasm. Our studies reveal a nuclear localization sequence in the C-terminal exons 7 and 8 of U2AF26 that differs from the known nuclear localization sequence in U2AF35. In addition, we could identify P32 as a protein that is able to interact with U2AF26 through this domain, and we demonstrate that this interaction is required for the nuclear translocation of U2AF26. Our results suggest the existence of two distinct nuclear import pathways for U2AF26 and U2AF35 that could independently control their intracellular distribution and availability to the splicing machinery. Such a mechanism could work in addition to the differential expression of U2AF homologs to contribute to the regulation of alternative splicing.

    The Journal of biological chemistry 2008;283;28;19636-45

  • The multifunctional protein GC1q-R interacts specifically with the i3 loop arginine cluster of the vasopressin V2 receptor.

    Granier S, Jean-Alphonse F, Bacqueville D, Monteil A, Pascal R, Poncet J, Guillon G, Boudier L, Arcemisbéhère L, Mouillac B, Bellot G, Déméné H and Mendre C

    CNRS, UMR 5203, Institut de Génomique fonctionnelle, Montpellier, France.

    In this study, we identified the multifunctional protein GC1q-R as a novel vasopressin V(2) receptor (V(2)R) interacting protein. For this purpose, we have developed a proteomic approach combining pull-down assays using a cyclic peptide mimicking the third intracellular loop of V(2)R as a bait and mass spectrometry analyses of proteins isolated from either rat or human kidney tissues or the HEK 293 cell line. Co-immunoprecipitation of GC1q-R with the c-Myc-tagged h-V(2)R expressed in a HEK cell line confirmed the existence of a specific interaction between GC1q-R and the V(2) receptor. Then, construction of a mutant receptor in i3 loop allowed us to identify the i3 loop arginine cluster of the vasopressin V(2) receptor as the interacting determinant for GC1q-R interaction. Using purified receptor as a bait and recombinant (74-282) GC1q-R, we demonstrated a direct and specific interaction between these two proteins via the arginine cluster.

    Regulatory peptides 2008;148;1-3;76-87

  • Mitochondrial p32 is a critical mediator of ARF-induced apoptosis.

    Itahana K and Zhang Y

    Department of Radiation Oncology, School of Medicine, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7512, USA.

    The shared exon 2 of the p14ARF-p16INK4a locus is frequently mutated in human cancers. However, in contrast to the exon 1beta-encoded N-terminal half of ARF, the function of the exon 2-encoded C-terminal half of ARF has been elusive. Here, we report that the mitochondrial protein p32/C1QBP binds the ARF C terminus. We show that p32 is required for ARF to localize to mitochondria and induce apoptosis, and that ARF mutations specifically disrupting p32 binding can impair both of these functions. Wild-type ARF, but not a p32-binding-deficient ARF mutant, localizes to mitochondria, reduces mitochondrial membrane potential, and sensitizes cells to p53-induced apoptosis. These findings provide a potential explanation for the frequent human cancer mutations targeting the ARF C terminus.

    Funded by: NCI NIH HHS: K01 CA087580, K01 CA087580-01, K01 CA087580-02, K01 CA087580-03, K01 CA087580-04, K01 CA087580-05, K01 CA087580-06, K01 CA087580-07, R01 CA100302

    Cancer cell 2008;13;6;542-53

  • HCV core protein interaction with gC1q receptor inhibits Th1 differentiation of CD4+ T cells via suppression of dendritic cell IL-12 production.

    Waggoner SN, Hall CH and Hahn YS

    Department of Microbiology, Beirne Carter Center for Immunology Research, University of Virginia, Charlottesville, Virginia 22903, USA

    Dendritic cells (DCs) isolated from patients with chronic hepatitis C virus (HCV) infection display an impaired capacity to generate type 1 CD4(+) T cell immunity. Several reports have described an immunomodulatory function for the HCV core protein, and circulating core has been shown to associate with the putative gC1q receptor, gC1qR, expressed on host immune cells. However, the molecular mechanism(s) of HCV core-mediated DC dysfunction has not been defined. Herein, ligation of gC1qR on human monocyte-derived DCs (MDDCs) with HCV core or anti-gC1qR agonist antibody was shown to inhibit TLR-induced IL-12 production but not the production of other TLR-stimulated cytokines. Furthermore, engagement of gC1qR on MDDCs resulted in reduced IFN-gamma secretion by allogeneic CD4(+) T lymphocytes during mixed lymphocyte culture. Differentiation of CD4(+) T cells cocultured with HCV core- or anti-gC1qR antibody-treated MDDCs was also skewed toward production of Th2 cytokines, including IL-4. Importantly, that addition of IL-12 rescued IFN-gamma production and Th1 differentiation by CD4(+) T cells. Therefore, engagement of gC1qR on DCs by HCV core limits the induction of Th1 responses and may contribute to viral persistence.

    Funded by: NIAID NIH HHS: 5T32AI10749608, AI057591

    Journal of leukocyte biology 2007;82;6;1407-19

  • Plasmodium falciparum uses gC1qR/HABP1/p32 as a receptor to bind to vascular endothelium and for platelet-mediated clumping.

    Biswas AK, Hafiz A, Banerjee B, Kim KS, Datta K and Chitnis CE

    Malaria Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India.

    The ability of Plasmodium falciparum-infected red blood cells (IRBCs) to bind to vascular endothelium, thus enabling sequestration in vital host organs, is an important pathogenic mechanism in malaria. Adhesion of P. falciparum IRBCs to platelets, which results in the formation of IRBC clumps, is another cytoadherence phenomenon that is associated with severe disease. Here, we have used in vitro cytoadherence assays to demonstrate, to our knowledge for the first time, that P. falciparum IRBCs use the 32-kDa human protein gC1qR/HABP1/p32 as a receptor to bind to human brain microvascular endothelial cells. In addition, we show that P. falciparum IRBCs can also bind to gC1qR/HABP1/p32 on platelets to form clumps. Our study has thus identified a novel host receptor that is used for both adhesion to vascular endothelium and platelet-mediated clumping. Given the association of adhesion to vascular endothelium and platelet-mediated clumping with severe disease, adhesion to gC1qR/HABP1/p32 by P. falciparum IRBCs may play an important role in malaria pathogenesis.

    Funded by: Wellcome Trust

    PLoS pathogens 2007;3;9;1271-80

  • The exosporium of B. cereus contains a binding site for gC1qR/p33: implication in spore attachment and/or entry.

    Ghebrehiwet B, Tantral L, Titmus MA, Panessa-Warren BJ, Tortora GT, Wong SS and Warren JB

    Stony Brook University, Department of Medicine, NY 11794, USA. berhane.ghebrehiwet@stonybrook.edu

    B. cereus, is a member of a genus of aerobic, gram-positive, spore-forming rod-like bacilli, which includes the deadly, B. anthracis. Preliminary experiments have shown that gC1qR binds to B. cereus spores that have been attached to microtiter plates. The present studies were therefore undertaken, to examine if cell surface gC1qR plays a role in B. cereus spore attachment and/or entry. Monolayers of human colon carcinoma (Caco-2) and lung cells were grown to confluency on 6 mm coverslips in shell vials with gentle swirling in a shaker incubator. Then, 2 microl of a suspension of strain SB460 B. cereus spores (3x10(8)/ml, in sterile water), were added and incubated (1-4 h; 36 degrees C) in the presence or absence of anti-gC1qR mAb-carbon nanoloops. Examination of these cells by EM revealed that: (1) When B. cereus endospores contacted the apical Caco-2 cell surface, or lung cells, gC1qR was simultaneously detectable, indicating upregulation of the molecule. (2) In areas showing spore contact with the cell surface, gC1qR expression was often adjacent to the spores in association with microvilli (Caco-2 cells) or cytoskeletal projections (lung cells). (3) Furthermore, the exosporia of the activated and germinating spores were often decorated with mAb-nanoloops. These observations were further corroborated by experiments in which B.cereus spores were readily taken up by monocytes and neutrophils, and this uptake was partially inhibited by mAb 60.11, which recognizes the C1q binding site on gC1qR. Taken together, the data suggest a role, for gC1qR at least in the initial stages of spore attachment and/or entry.

    Funded by: NIAID NIH HHS: R01 AI060866, R01 AI060866-03, R01-AI 060866

    Advances in experimental medicine and biology 2007;598;181-97

  • Protruding disordered loop of gC1qR is specifically exposed and related to antiapoptotic property in germ cell lineage.

    Kitazawa S, Takenaka A, Kondo T, Mizoguchi A and Kitazawa R

    Division of Molecular Pathology, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan. kitazawa@med.kobe-u.ac.jp

    We established a monoclonal antibody (MAb), 5G9, with the use of a fixed seminoma tissue from an archival paraffin-embedded specimen, as an immunogen. Without antigen retrieval, positive 5G9-immunohistochemical staining was confined mostly to primordial germ cells, spermatogonia and various germ cell tumors. 5G9 recognized a mitochondrial 32-kD protein with an isoelectric point of pH 4.2, identified as a multifunctional ubiquitous protein, receptor for globular head of C1q (gC1qR), whose epitope was mapped in a disordered loop connecting the beta3 and the beta4 strands. Reflecting the ubiquitous distribution of gC1qR, with antigen retrieval, 5G9 was found reactive to a wide range of normal and tumor tissues. Since several co-precipitated and phosphorylated bands were observed in various human cell lines but not in germ cell tumor cell lines by in vitro phosphorylation assay, we speculate that the epitope of gC1qR is specifically unmasked in the germ cell lineage. By reducing gC1qR by siRNA, a significant increase was observed in the number of apoptotic cells in ITO-II and TCam-2 cell lines, but to a lesser extent in the Colo201 colon cancer cell line, showing an antiapoptotic property of gC1qR in the germ cells. Since protein-protein interaction is partially preserved by fixation, archival paraffin-embedded specimens can be a valuable source of immunogens for generating monoclonal antibodies (MAbs) that recognize tissue-specific protein conformation.

    Histochemistry and cell biology 2006;126;6;665-77

  • A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration.

    Lim J, Hao T, Shaw C, Patel AJ, Szabó G, Rual JF, Fisk CJ, Li N, Smolyar A, Hill DE, Barabási AL, Vidal M and Zoghbi HY

    Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA.

    Many human inherited neurodegenerative disorders are characterized by loss of balance due to cerebellar Purkinje cell (PC) degeneration. Although the disease-causing mutations have been identified for a number of these disorders, the normal functions of the proteins involved remain, in many cases, unknown. To gain insight into the function of proteins involved in PC degeneration, we developed an interaction network for 54 proteins involved in 23 inherited ataxias and expanded the network by incorporating literature-curated and evolutionarily conserved interactions. We identified 770 mostly novel protein-protein interactions using a stringent yeast two-hybrid screen; of 75 pairs tested, 83% of the interactions were verified in mammalian cells. Many ataxia-causing proteins share interacting partners, a subset of which have been found to modify neurodegeneration in animal models. This interactome thus provides a tool for understanding pathogenic mechanisms common for this class of neurodegenerative disorders and for identifying candidate genes for inherited ataxias.

    Funded by: NICHD NIH HHS: HD24064; NINDS NIH HHS: NS27699

    Cell 2006;125;4;801-14

  • Cellular splicing and transcription regulatory protein p32 represses adenovirus major late transcription and causes hyperphosphorylation of RNA polymerase II.

    Ohrmalm C and Akusjärvi G

    Department of Medical Biochemistry and Microbiology, Uppsala Biomedical Center, Husargatan 3, S-751 23 Uppsala, Sweden.

    The cellular protein p32 is a multifunctional protein, which has been shown to interact with a large number of cellular and viral proteins and to regulate several important activities like transcription and RNA splicing. We have previously shown that p32 regulates RNA splicing by binding and inhibiting the essential SR protein ASF/SF2. To determine whether p32 also functions as a regulator of splicing in virus-infected cells, we constructed a recombinant adenovirus expressing p32 under the transcriptional control of an inducible promoter. Much to our surprise the results showed that p32 overexpression effectively blocked mRNA and protein expression from the adenovirus major late transcription unit (MLTU). Interestingly, the p32-mediated inhibition of MLTU transcription was accompanied by an approximately 4.5-fold increase in Ser 5 phosphorylation and an approximately 2-fold increase in Ser 2 phosphorylation of the carboxy-terminal domain (CTD). Further, in p32-overexpressing cells the efficiency of RNA polymerase elongation was reduced approximately twofold, resulting in a decrease in the number of polymerase molecules that reached the end of the major late L1 transcription unit. We further show that p32 stimulates CTD phosphorylation in vitro. The inhibitory effect of p32 on MLTU transcription appears to require the CAAT box element in the major late promoter, suggesting that p32 may become tethered to the MLTU via an interaction with the CAAT box binding transcription factor.

    Journal of virology 2006;80;10;5010-20

  • Acetylated Tat regulates human immunodeficiency virus type 1 splicing through its interaction with the splicing regulator p32.

    Berro R, Kehn K, de la Fuente C, Pumfery A, Adair R, Wade J, Colberg-Poley AM, Hiscott J and Kashanchi F

    Genetics Program, The George Washington University, Washington, DC 20037, USA.

    The human immunodeficiency virus type 1 (HIV-1) potent transactivator Tat protein mediates pleiotropic effects on various cell functions. Posttranslational modification of Tat affects its activity during viral transcription. Tat binds to TAR and subsequently becomes acetylated on lysine residues by histone acetyltransferases. Novel protein-protein interaction domains on acetylated Tat are then established, which are necessary for both sustained transcriptional activation of the HIV-1 promoter and viral transcription elongation. In this study, we investigated the identity of proteins that preferentially bound acetylated Tat. Using a proteomic approach, we identified a number of proteins that preferentially bound AcTat, among which p32, a cofactor of splicing factor ASF/SF-2, was identified. We found that p32 was recruited to the HIV-1 genome, suggesting a mechanism by which acetylation of Tat may inhibit HIV-1 splicing needed for the production of full-length transcripts. Using Tat from different clades, harboring a different number of acetylation sites, as well as Tat mutated at lysine residues, we demonstrated that Tat acetylation affected splicing in vivo. Finally, using confocal microscopy, we found that p32 and Tat colocalize in vivo in HIV-1-infected cells.

    Funded by: NIAID NIH HHS: AI43894, AI44357, R01 AI043894; PHS HHS: 13969, A146459; Unspecified: R29 AI044357

    Journal of virology 2006;80;7;3189-204

  • Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins.

    Nery FC, Rui E, Kuniyoshi TM and Kobarg J

    Centro de Biologia Molecular Estrutural, Laboratório Nacional de Luz Síncrotron, Rua Giuseppe Máximo Scolfaro 10.000, C.P. 6192, 13084-971 Campinas, SP, Brazil.

    Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro.

    Biochemical and biophysical research communications 2006;341;3;847-55

  • Chemotaxis of human monocyte-derived dendritic cells to complement component C1q is mediated by the receptors gC1qR and cC1qR.

    Vegh Z, Kew RR, Gruber BL and Ghebrehiwet B

    Department of Medicine, Stony Brook University School of Medicine, Stony Brook, NY 11794-8161, USA.

    Dendritic cells (DCs) are recruited to inflammatory sites where they phagocytose and process antigens for subsequent presentation to the T lymphocytes in the lymphoid tissue. Several leukocyte chemoattractants and their specific receptors have been shown to induce the migration of DC. The complement protein C1q has multiple immune functions including acting as a chemoattractant for neutrophils, eosinophils and mast cells. Therefore, the objective of this study was to determine if soluble C1q can induce chemotaxis of DC. Culturing cells in GM-CSF and IL-4 for 5 to 7 days generated human monocyte-derived DCs. In addition, LPS was added from day 5 to 7 to induce DC maturation. Cells were classified as either immature or mature DC by assessing the cell surface markers by flow cytometry, phagocytosis of dextran-FITC and T cell proliferation in an allogenic MLR. Immature DCs express the C1q receptors (C1qR), gC1qR and cC1qR/CR and, accordingly, display a vigorous migratory response to soluble C1q with maximal cell movement observed at 10-50nM. In contrast, mature DCs neither express C1qR nor do move to a gradient of soluble C1q. Varying the concentration gradient of C1q (checkerboard assay) showed that the protein largely induces a chemotactic response. Finally, blocking gC1qR and cC1qR/CR by using specific antibodies abolished the chemotactic response to C1q but had no effect on a different chemoattractant C5a. These results clearly demonstrate that C1q functions as a chemotactic factor for immature DC, and migration is mediated through ligation of both gC1qR and cC1qR/CR.

    Funded by: NIGMS NIH HHS: GM 63769

    Molecular immunology 2006;43;9;1402-7

  • gC1qR/p33 serves as a molecular bridge between the complement and contact activation systems and is an important catalyst in inflammation.

    Ghebrehiwet B, CebadaMora C, Tantral L, Jesty J and Peerschke EI

    Department of Medicine, SUNY at Stony Brook, Stony Brook, NY 11794, USA.

    The receptor for the globular heads of C1q, gC1qR/p33, is a ubiquitously expressed protein, which is distributed both intracellularly and on the cell-surface protein. In addition to C1q, this molecule also is able to bind several other biologically important plasma ligands, including high-molecular-weight kininogen (HK), factor XII (FXII), and multimeric vitronectin. Previous studies have shown that incubation of FXII, prekallikrein, and HK with gC1qR leads to a zinc-dependent and FXII-dependent conversion of prekallikrein to kallikrein, a requisite for kinin generation. In addition, these studies showed that normal plasma, but not plasma deficient in FXII, PK, or HK, activate upon binding to endothelial cells (EC), and that this activation could be inhibited by antibody to gClqR. In these studies, we show that incubation of serum with microtiter plate bound gC1qR results in complement activation, as evidenced by the binding and activation of C1 and generation of C4d. However, neither Clq-deficient serum nor a truncated form of gC1qR (gC1qRA74-96), supported complement activation. Taken together, the data strongly suggest that at sites of inflammation, such as vasculitis and atherosclerosis, where gC1qR as well as its two important plasma ligands, C1q and HK, have been shown to be simultaneously present, soluble or cell-surface-expressed gC1qR may contribute to the inflammatory process by modulating complement activation, kinin generation, and perhaps even initiation of clotting via the contact system. Based on these and other published data, we propose a model of inflammation in which atherogenic factors (e.g., immune complexes, virus, or bacteria) are perceived not only to convert the endothelium into a procoagulant and proinflammatory surface, but also to induce enhanced expression of cell surface molecules such as gC1qR. Enhanced expression of gC1qR in turn leads to: (i) high-affinity C1q binding and cell production of proinflammatory factors, and (ii) high-affinity HK binding and facilitation of the assembly of contact activation proteins leading to generation of bradykinin and possibly coagulation through activation of FXI.

    Funded by: NHLBI NIH HHS: NHLBI 67211

    Advances in experimental medicine and biology 2006;586;95-105

  • gC1q receptor ligation selectively down-regulates human IL-12 production through activation of the phosphoinositide 3-kinase pathway.

    Waggoner SN, Cruise MW, Kassel R and Hahn YS

    Beirne Carter Center for Immunology Research, University of Virginia, Charlottesville 22908, USA.

    gC1qR, a complement receptor for C1q, plays a pivotal role in the regulation of inflammatory and antiviral T cell responses. Several pathogens, including hepatitis C virus, exploit gC1qR-dependent regulatory pathways to manipulate host immunity. However, the molecular mechanism(s) of gC1qR signaling involved in regulating inflammatory responses remains unknown. We report the selective inhibition of TLR4-induced IL-12 production after cross-linking of gC1qR on the surface of macrophages and dendritic cells. Suppression of IL-12 did not result from increased IL-10 or TGF-beta, but was dependent on PI3K activation. Activation of PI3K and subsequent phosphorylation of Akt define an intracellular pathway mediating gC1qR signaling and cross-talk with TLR4 signaling. This is the first report to identify signaling pathways used by gC1qR-mediated immune suppression, and it establishes a means of complement-mediated immune suppression to inhibit Th1 immunity crucial for clearing pathogenic infection.

    Funded by: NIAID NIH HHS: 5T32AI10749608, AIO57591

    Journal of immunology (Baltimore, Md. : 1950) 2005;175;7;4706-14

  • HABP1/p32/gC1qR induces aberrant growth and morphology in Schizosaccharomyces pombe through its N-terminal alpha helix.

    Mallick J and Datta K

    Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi-110067, India.

    Hyaluronan binding protein (HABP1), located on human chromosome 17p13.3, was identified and characterized as being involved in cellular signaling from our laboratory. Here, we demonstrate that HABP1 expression in Schizosaccharomyces pombe induces growth inhibition, morphological abnormalities like elongation, multinucleation and aberrant cell septum formation in several strains of S. pombe, implicating its role in cell cycle progression and cytokinesis. This argument is further strengthened by an observed delay in the maximal expression of cell cycle regulatory proteins like CDC 2 and CDC 25 coupled to the direct interaction of HABP1 with CDC 25. In order to pinpoint the interacting domain of HABP1, its N- and C-terminal truncated variants (DeltaN.HABP1 and DeltaC.HABP1, respectively) were utilized which revealed that while expression of the former did not alter the phenotype, the latter generated morphological changes similar to those imparted upon HABP1 expression. It was also noted that along with HABP1, DeltaC.HABP1 too directly interacts with CDC 25 while DeltaN.HABP1 does not. Taken together, these data suggest that HABP1 induces morphological changes and modulates the cell cycle by interacting with proteins like CDC 25 through its N-terminal alpha-helix.

    Experimental cell research 2005;309;2;250-63

  • Induction of p38- and gC1qR-dependent IL-8 expression in pulmonary fibroblasts by soluble hepatitis C core protein.

    Moorman JP, Fitzgerald SM, Prayther DC, Lee SA, Chi DS and Krishnaswamy G

    Department of Internal Medicine, James H. Quillen College of Medicine, East Tennessee State University, Johnson City, TN, USA. moorman@mail.etsu.edu

    Background: Recent studies suggest that HCV infection is associated with progressive declines in pulmonary function in patients with underlying pulmonary diseases such as asthma and chronic obstructive pulmonary disease. Few molecular studies have addressed the inflammatory aspects of HCV-associated pulmonary disease. Because IL-8 plays a fundamental role in reactive airway diseases, we examined IL-8 signaling in normal human lung fibroblasts (NHLF) in response to the HCV nucleocapsid core protein, a viral antigen shown to modulate intracellular signaling pathways involved in cell proliferation, apoptosis and inflammation.

    Methods: NHLF were treated with HCV core protein and assayed for IL-8 expression, phosphorylation of the p38 MAPK pathway, and for the effect of p38 inhibition.

    Results: Our studies demonstrate that soluble HCV core protein induces significant increases in both IL-8 mRNA and protein expression in a dose- and time-dependent manner. Treatment with HCV core led to phosphorylation of p38 MAPK, and expression of IL-8 was dependent upon p38 activation. Using TNFalpha as a co-stimulant, we observed additive increases in IL-8 expression. HCV core-mediated expression of IL-8 was inhibited by blocking gC1qR, a known receptor for soluble HCV core linked to MAPK signaling.

    Conclusion: These studies suggest that HCV core protein can lead to enhanced p38- and gC1qR-dependent IL-8 expression. Such a pro-inflammatory role may contribute to the progressive deterioration in pulmonary function recently recognized in individuals chronically infected with HCV.

    Funded by: NHLBI NIH HHS: R01 HL-63070; NIAID NIH HHS: R15 AI-43310

    Respiratory research 2005;6;105

  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).

    Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Morrin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J and MGC Project Team

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.

    Funded by: PHS HHS: N01-C0-12400

    Genome research 2004;14;10B;2121-7

  • Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation.

    Peerschke EI, Petrovan RJ, Ghebrehiwet B and Ruf W

    New York Presbyterian Hospital, Weill-Cornell Center, 525 East 68th Street, Room F715, New York 10021, USA. epeersch@med.cornell.edu

    Evidence is accumulating to suggest that TFPI-2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. Recent immunohistochemical studies of advanced atherosclerotic lesions, demonstrated a similar tissue distribution for TFPI-2, High Molecular Weight Kininogen (HK), and gC1qR/p33 (gC1qR), a ubiquitously expressed, multicompartmental cellular protein involved in modulating complement, coagulation, and kinin cascades. Further studies to evaluate TFPI-2 interactions with gC1qR demonstrated direct interactions between gC1qR and TFPI-2 using immunoprecipitation and solid phase binding studies. Specific and saturable binding between TFPI-2 and gC1qR (estimated Kd: approximately 70 nM) was observed by ELISA and surface plasmon resonance (Biacore) binding assays. Binding was inhibited by antibodies to gC1qR, and was strongly dependent on the Kunitz-2 domain of TFPI-2, as deletion of this domain reduced gC1qR-TFPI-2 interactions by approximately 75%. Deletion of gC1qR amino acids 74-95, involved in C1q binding, had no effect on gC1qR binding to TFPI-2, although antibodies to this region and purified C1q both inhibited binding, most likely via allosteric effects. In contrast, HK did not affect TFPI-2 binding to gC1qR. Binding of TFPI-2 to gC1qR produced statistically significant but modest reductions in TFPI-2 inhibition of plasmin, but had no effect on kallikrein inhibition in fluid phase chromogenic assays. Taken together, these data suggest that gC1qR may participate in tissue remodeling and inflammation by localizing TFPI-2 to the pericellular environment to modulate local protease activity and regulate HK activation.

    Funded by: NHLBI NIH HHS: HL-67211

    Thrombosis and haemostasis 2004;92;4;811-9

  • Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization.

    Jin J, Smith FD, Stark C, Wells CD, Fawcett JP, Kulkarni S, Metalnikov P, O'Donnell P, Taylor P, Taylor L, Zougman A, Woodgett JR, Langeberg LK, Scott JD and Pawson T

    Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada.

    Background: 14-3-3 proteins are abundant and conserved polypeptides that mediate the cellular effects of basophilic protein kinases through their ability to bind specific peptide motifs phosphorylated on serine or threonine.

    Results: We have used mass spectrometry to analyze proteins that associate with 14-3-3 isoforms in HEK293 cells. This identified 170 unique 14-3-3-associated proteins, which show only modest overlap with previous 14-3-3 binding partners isolated by affinity chromatography. To explore this large set of proteins, we developed a domain-based hierarchical clustering technique that distinguishes structurally and functionally related subsets of 14-3-3 target proteins. This analysis revealed a large group of 14-3-3 binding partners that regulate cytoskeletal architecture. Inhibition of 14-3-3 phosphoprotein recognition in vivo indicates the general importance of such interactions in cellular morphology and membrane dynamics. Using tandem proteomic and biochemical approaches, we identify a phospho-dependent 14-3-3 binding site on the A kinase anchoring protein (AKAP)-Lbc, a guanine nucleotide exchange factor (GEF) for the Rho GTPase. 14-3-3 binding to AKAP-Lbc, induced by PKA, suppresses Rho activation in vivo.

    Conclusion: 14-3-3 proteins can potentially engage around 0.6% of the human proteome. Domain-based clustering has identified specific subsets of 14-3-3 targets, including numerous proteins involved in the dynamic control of cell architecture. This notion has been validated by the broad inhibition of 14-3-3 phosphorylation-dependent binding in vivo and by the specific analysis of AKAP-Lbc, a RhoGEF that is controlled by its interaction with 14-3-3.

    Funded by: NIDDK NIH HHS: DK44239

    Current biology : CB 2004;14;16;1436-50

  • A protein interaction framework for human mRNA degradation.

    Lehner B and Sanderson CM

    MRC Rosalind Franklin Centre for Genomics Research, Hinxton, Cambridge CB10 1SB, United Kingdom.

    The degradation of mRNA is an important regulatory step in the control of gene expression. However, mammalian RNA decay pathways remain poorly characterized. To provide a framework for studying mammalian RNA decay, a two-hybrid protein interaction map was generated using 54 constructs from 38 human proteins predicted to function in mRNA decay. The results provide evidence for interactions between many different proteins required for mRNA decay. Of particular interest are interactions between the poly(A) ribonuclease and the exosome and between the Lsm complex, decapping factors, and 5'-->3' exonucleases. Moreover, multiple interactions connect 5'-->3' and 3'-->5' decay proteins to each other and to nonsense-mediated decay factors, providing the opportunity for coordination between decay pathways. The interaction network also predicts the internal organization of the exosome and Lsm complexes. Additional interactions connect mRNA decay factors to many novel proteins and to proteins required for other steps in gene expression. These results provide an experimental insight into the organization of proteins required for mRNA decay and their coupling to other cellular processes, and the physiological relevance of many of these interactions are supported by their evolutionary conservation. The interactions also provide a wealth of hypotheses to guide future research on mRNA degradation and demonstrate the power of exhaustive protein interaction mapping in aiding understanding of uncharacterized protein complexes and pathways.

    Genome research 2004;14;7;1315-23

  • Physical and functional interaction between BH3-only protein Hrk and mitochondrial pore-forming protein p32.

    Sunayama J, Ando Y, Itoh N, Tomiyama A, Sakurada K, Sugiyama A, Kang D, Tashiro F, Gotoh Y, Kuchino Y and Kitanaka C

    Institute of Molecular and Cellular Biosciences, University of Tokyo, Tokyo, Japan.

    Bcl-2 homology domain (BH) 3-only proteins of the proapoptotic Bcl-2 subfamily play a key role as initiators of mitochondria-dependent apoptosis. To date, at least 10 mammalian BH3-only proteins have been identified, and it is now being realized that they have different roles and mechanisms of regulation in the transduction of apoptotic signals to mitochondria. Hrk/DP5 is one of the mammalian BH3-only proteins implicated in a variety of physiological and pathological apoptosis, yet the molecular mechanism involved in Hrk-mediated apoptosis remains poorly understood. In an attempt to identify cellular proteins participating in Hrk-mediated apoptosis, we have conducted yeast two-hybrid screening for Hrk-interacting proteins and isolated p32, a mitochondrial protein that has been shown to form a channel consisting of its homotrimer. In vitro binding, co-immunoprecipitation, as well as immunocytochemical analyses verified specific interaction and colocalization of Hrk and p32, both of which depended on the presence of the highly conserved C-terminal region of p32. Importantly, Hrk-induced apoptosis was suppressed by the expression of p32 mutants lacking the N-terminal mitochondrial signal sequence (p32(74-282)) and the conserved C-terminal region (p32 (1-221)), which are expected to inhibit binding of Hrk competitively to the endogenous p32 protein and to disrupt the channel function of p32, respectively. Furthermore, small interfering RNA-mediated knockdown of p32 conferred protection against Hrk-induced apoptosis. Altogether, these results suggest that p32 may be a key molecule that links Hrk to mitochondria and is critically involved in the regulation of Hrk-mediated apoptosis.

    Cell death and differentiation 2004;11;7;771-81

  • Direct binding of hepatitis C virus core to gC1qR on CD4+ and CD8+ T cells leads to impaired activation of Lck and Akt.

    Yao ZQ, Eisen-Vandervelde A, Waggoner SN, Cale EM and Hahn YS

    Department of Microbiology and Beirne Carter Center, University of Virginia, HSC Box 801386, Charlottesville, VA 22908, USA.

    Complement plays a pivotal role in the regulation of innate and adaptive immunity. It has been shown that the binding of C1q, a natural ligand of gC1qR, on T cells inhibits their proliferation. Here, we demonstrate that direct binding of the hepatitis C virus (HCV) core to gC1qR on T cells leads to impaired Lck/Akt activation and T-cell function. The HCV core associates with the surface of T cells specifically via gC1qR, as this binding is inhibited by the addition of either anti-gC1qR antibody or soluble gC1qR. The binding affinity constant of core protein for gC1qR, as determined by BIAcore analysis, is 3.8 x 10(-7) M. The specificity of the HCV core-gC1qR interaction is confirmed by reduced core binding on Molt-4 T cells treated with gC1qR-silencing small interfering RNA and enhanced core binding on GPC-16 guinea pig cells transfected with human gC1qR. Interestingly, gC1qR is expressed at higher levels on CD8(+) than on CD4(+) T cells, resulting in more severe core-induced suppression of the CD8(+)-T-cell population. Importantly, T-cell receptor-mediated activation of the Src kinases Lck and ZAP-70 but not Fyn and the phosphorylation of Akt are impaired by the HCV core, suggesting that it inhibits the very early events of T-cell activation.

    Funded by: NIDDK NIH HHS: DK 066754, R01 DK066754

    Journal of virology 2004;78;12;6409-19

  • A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway.

    Bouwmeester T, Bauch A, Ruffner H, Angrand PO, Bergamini G, Croughton K, Cruciat C, Eberhard D, Gagneur J, Ghidelli S, Hopf C, Huhse B, Mangano R, Michon AM, Schirle M, Schlegl J, Schwab M, Stein MA, Bauer A, Casari G, Drewes G, Gavin AC, Jackson DB, Joberty G, Neubauer G, Rick J, Kuster B and Superti-Furga G

    Cellzome AG, Meyerhofstrasse 1, 69117 Heidelberg, Germany. tewis.bouwmeester@cellzome.com

    Signal transduction pathways are modular composites of functionally interdependent sets of proteins that act in a coordinated fashion to transform environmental information into a phenotypic response. The pro-inflammatory cytokine tumour necrosis factor (TNF)-alpha triggers a signalling cascade, converging on the activation of the transcription factor NF-kappa B, which forms the basis for numerous physiological and pathological processes. Here we report the mapping of a protein interaction network around 32 known and candidate TNF-alpha/NF-kappa B pathway components by using an integrated approach comprising tandem affinity purification, liquid-chromatography tandem mass spectrometry, network analysis and directed functional perturbation studies using RNA interference. We identified 221 molecular associations and 80 previously unknown interactors, including 10 new functional modulators of the pathway. This systems approach provides significant insight into the logic of the TNF-alpha/NF-kappa B pathway and is generally applicable to other pathways relevant to human disease.

    Nature cell biology 2004;6;2;97-105

  • Human fibrillarin forms a sub-complex with splicing factor 2-associated p32, protein arginine methyltransferases, and tubulins alpha 3 and beta 1 that is independent of its association with preribosomal ribonucleoprotein complexes.

    Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T and Takahashi N

    Department of Applied Biological Science, United Graduate School of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509.

    Fibrillarin (FIB, Nop1p in yeast) is an RNA methyltransferase found not only in the fibrillar region of the nucleolus but also in Cajal bodies. FIB is essential for efficient processing of preribosomal RNA during ribosome biogenesis, although its precise function in this process and its role in Cajal bodies remain uncertain. Here, we demonstrate that the human FIB N-terminal glycine- and arginine-rich domain (residues 1-77) and its spacer region 1 (78-132) interact with splicing factor 2-associated p32 (SF2A-p32) and that the FIB methyltransferase-like domain (133-321) interacts with protein-arginine methyltransferase 5 (PRMT5, Janus kinase-binding protein 1). We also show that these proteins associate with several additional proteins, including PRMT1, tubulin alpha 3, and tubulin beta 1 to form a sub-complex that is principally independent of the association of FIB with preribosomal ribonucleoprotein complexes that co-immunoprecipitate with the sub-complex in human cells expressing FLAG-tagged FIB. Based on the physical association of FIB with SF2A-p32 and PRMTs, as well as the other reported results, we propose that FIB may coordinate both RNA and protein methylation during the processes of ribosome biogenesis in the nucleolus and RNA editing such as small nuclear (nucleolar) ribonucleoprotein biogenesis in Cajal bodies.

    The Journal of biological chemistry 2004;279;3;1607-14

  • Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins encoded within the human MHC class III region.

    Lehner B, Semple JI, Brown SE, Counsell D, Campbell RD and Sanderson CM

    Functional Genomics Group, MRC Rosalind Franklin Centre for Genomics Research, Hinxton, Cambridge, United Kingdom.

    High-throughput (HTP) protein-interaction assays, such as the yeast two-hybrid (Y2H) system, are enormously useful in predicting the functions of novel gene-products. HTP-Y2H screens typically do not include all of the reconfirmation and specificity tests used in small-scale studies, but the effects of omitting these steps have not been assessed. We performed HTP-Y2H screens that included all standard controls, using the predicted intracellular proteins expressed from the human MHC class III region, a region of the genome associated with many autoimmune diseases. The 91 novel interactions identified provide insight into the potential functions of many MHC genes, including C6orf47, LSM2, NELF-E (RDBP), DOM3Z, STK19, PBX2, RNF5, UAP56 (BAT1), ATP6G2, LST1/f, BAT2, Scythe (BAT3), CSNK2B, BAT5, and CLIC1. Surprisingly, our results predict that 1/3 of the proteins may have a role in mRNA processing, which suggests clustering of functionally related genes within the human genome. Most importantly, our analysis shows that omitting standard controls in HTP-Y2H screens could significantly compromise data quality.

    Genomics 2004;83;1;153-67

  • Human p32, interacts with B subunit of the CCAAT-binding factor, CBF/NF-Y, and inhibits CBF-mediated transcription activation in vitro.

    Chattopadhyay C, Hawke D, Kobayashi R and Maity SN

    Department of Molecular Genetics, M.D. Anderson Cancer Center and Genes, Graduate School of Biomedical Sciences, The University of Texas, Houston, TX 77030, USA.

    To understand the role of the CCAAT-binding factor, CBF, in transcription, we developed a strategy to purify the heterotrimeric CBF complex from HeLa cell extracts using two successive immunoaffinity chromatography steps. Here we show that the p32 protein, previously identified as the ASF/SF2 splicing factor-associated protein, copurified with the CBF complex. Studies of protein-protein interaction demonstrated that p32 interacts specifically with CBF-B subunit and also associates with CBF-DNA complex. Cellular localization by immunofluorescence staining revealed that p32 is present in the cell throughout the cytosol and nucleus, whereas CBF is present primarily in the nucleus. A portion of the p32 colocalizes with CBF-B in the nucleus. Interestingly, reconstitution of p32 in an in vitro transcription reaction demonstrated that p32 specifically inhibits CBF-mediated transcription activation. Altogether, our study identified p32 as a novel and specific corepressor of CBF-mediated transcription activation in vitro.

    Funded by: NCI NIH HHS: CA16672, P30 CA016672; NIAMS NIH HHS: AR46264, R01 AR046264

    Nucleic acids research 2004;32;12;3632-41

  • Human p32 protein relieves a post-transcriptional block to HIV replication in murine cells.

    Zheng YH, Yu HF and Peterlin BM

    Department of Medicine, Rosalind Russell Medical Research Center, Mt. Zion Research Building Room N231, 2340 Sutter Street, University of California, San Francisco, CA 94115, USA.

    In the mouse, replication of human immunodeficiency virus type 1 (HIV) is blocked at the levels of entry, transcription and assembly. For the latter effect, the amounts of unspliced viral genomic RNA could have an important function. Indeed, in murine cells, HIV transcripts are spliced excessively, a process that is not inhibited by the murine splicing inhibitor p32 (mp32). In marked contrast, its human counterpart, hp32, not only blocks this splicing but promotes the accumulation of viral genomic transcripts and structural proteins, resulting in the assembly and release of infectious virions. A single substitution in hp32 of Gly 35 to Asp 35, which is found in mp32, abrogates this ac 532 tivity. Thus, hp32 overcomes an important post-transcriptional block to HIV replication in murine cells.

    Nature cell biology 2003;5;7;611-8

  • Activation-dependent surface expression of gC1qR/p33 on human blood platelets.

    Peerschke EI, Murphy TK and Ghebrehiwet B

    Department of Pathology, Weill Medical College of Cornell University, New York, New York 10021, USA. epeersch@med.cornell.edu

    GC1qR/p33 (gC1qR) is expressed by a variety of somatic and cultured cells, including blood platelets. It interacts with several cellular, viral, bacterial, and plasma proteins, suggesting a potential role in thrombosis, inflammation, and infection. Considerable controversy has surrounded the surface membrane localization of gC1qR, however, since its cDNA sequence does not predict a traditional membrane-anchoring domain, and bears a typical mitochondrial targeting sequence. The present study examined gC1qR expression on resting and activated human blood platelets using flow cytometry and confocal microscopy with two monoclonal antibodies, 74.5.2 and 60.11, directed against gC1qR C-terminal amino acids 204-218, and N-terminal amino acids 76-93, respectively. Unstimulated platelets reacted minimally with either antibody. In contrast, platelet activation with TRAP, epinephrine, or ADP produced markedly increased gC1qR expression as reflected by 74.5.2 binding but not 60.11 binding. Platelet activation was verified using PAC-1 and anti CD 62 antibodies. Whereas PAC-1 binding to activated platelets could be reversed following platelet incubation with PGE1, 74.5.2 binding remained unchanged, suggesting the sustained expression of gC1qR following platelet stimulation. The data further demonstrate that detection of cell surface gC1qR may be dependent on antibody specificity. The ability of gC1qR to bind proteins involved in complement, coagulation, and kinin systems, as well as viral and bacterial pathogens including S. aureus protein A, supports the hypothesis that gC1qR expressed on activated platelets may contribute directly to thrombosis, inflammation, and endovascular infections.

    Funded by: NHLBI NIH HHS: HL67211

    Thrombosis and haemostasis 2003;89;2;331-9

  • Maturation-dependent expression of C1q binding proteins on the cell surface of human monocyte-derived dendritic cells.

    Vegh Z, Goyarts EC, Rozengarten K, Mazumder A and Ghebrehiwet B

    Department of Medicine, Division of Medical Oncology, The Cancer Center of Long Island, State University of New York, Stony Brook, NY, USA.

    The expression and cell surface levels of many important receptors are dependent on the maturation stage of dendritic cells (DCs), and related to the unique function of immature and mature DCs. In this report, we show, for the first time, that human monocyte-derived DCs express two types of C1q receptors, gC1qR and cC1qR. Furthermore, immature DCs secrete detectable amount of C1q into the culture supernatant. Immature DCs express higher cell surface levels of both C1qRs than mature ones, while the total C1qR protein and mRNA levels remain the same. The following experimental evidence support this conclusion: (1) Inflammatory cytokines and LPS, which induce maturation of DCs, downregulate surface expression of both C1qR molecules. (2) Cytokines and drugs (IL-10, IFN-alpha, Dexamethasone), which keep DCs phenotypically and functionally immature, significantly upregulate the cell surface expression of both C1qRs. (3) Neither of these treatments changed the intracellular gC1qR level nor the gC1qR mRNA levels measured by real time RT-PCR. The elevated surface expression of C1qRs on DCs has been found to be not due to increased apoptosis or cell death as the result of DC treatment. Taken together, these data show that human monocyte-derived DCs express gC1qR and cC1qR, their expression on the cell surface is maturation dependent, and immature DCs secrete C1q. These data strongly suggest the role of C1qRs in immature DC function and in the regulation of immune processes.

    International immunopharmacology 2003;3;1;39-51

  • Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome.

    Majumdar M, Bharadwaj A, Ghosh I, Ramachandran S and Datta K

    Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, India.

    The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.

    DNA and cell biology 2002;21;10;727-35

  • The cytoplasmic tail peptide sequence of membrane type-1 matrix metalloproteinase (MT1-MMP) directly binds to gC1qR, a compartment-specific chaperone-like regulatory protein.

    Rozanov DV, Ghebrehiwet B, Ratnikov B, Monosov EZ, Deryugina EI and Strongin AY

    The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037, USA.

    Membrane type-1 matrix metalloproteinase (MT1-MMP), a key enzyme in cell locomotion, is known to be primarily recruited to the leading edge of migrating cells. This raises a possibility that the C-terminal cytoplasmic tail of MT1-MMP interacts with intracellular regulatory proteins, which modulate translocations of the protease across the cell. Here, we demonstrated that MT1-MMP via its cytoplasmic tail directly associates with a chaperone-like compartment-specific regulator gC1qR. Although a direct functional link between these two proteins remains uncertain, our observations suggest that the transient associations of gC1qR with the cytoplasmic tail of MT1-MMP are likely to be involved in the mechanisms regulating presentation of the protease at the tumor cell surface.

    Funded by: NCI NIH HHS: CA77410, CA83017

    FEBS letters 2002;527;1-3;51-7

  • The hemopexin-like C-terminal domain of membrane type 1 matrix metalloproteinase regulates proteolysis of a multifunctional protein, gC1qR.

    Rozanov DV, Ghebrehiwet B, Postnova TI, Eichinger A, Deryugina EI and Strongin AY

    Burnham Institute, La Jolla, California 92037, USA.

    Matrix metalloproteinases (MMPs) including membrane type 1 MMP (MT1-MMP) can degrade extracellular matrix and cell surface receptor molecules and have an essential function in malignancy. Recently, we established a functional link between MT1-MMP and the receptor of complement component 1q (gC1qR). The gC1qR is known as a compartment-specific regulator of diverse cellular and viral proteins. Once released by proliferating cells, soluble gC1qR may inhibit complement component 1q hemolytic activity and play important roles in vivo in assisting tumor cells to evade destruction by complement. Here, we report that gC1qR is susceptible to MT1-MMP proteolysis in vitro and in cell cultures. The major MT1-MMP cleavage site (Gly(79) down arrow Gln(80)) is localized within the structurally disordered loop connecting the beta(3) and the beta(4) strands of gC1qR. The recombinant MT1-MMP construct that included the catalytic domain but lacked the hemopexin-like domain lost the proteolytic capacity; however, it retained the ability to bind gC1qR. Inhibition of MT1-MMP activity by a hydroxamate inhibitor converted the protease into a cell surface receptor of gC1qR and promoted co-precipitation MT1-MMP with the soluble gC1qR protein. It is tempting to hypothesize that these novel mechanisms may play important roles in vivo and have to be taken into account in designing hydroxamate-based cancer therapy.

    Funded by: NCI NIH HHS: CA77470, CA83017

    The Journal of biological chemistry 2002;277;11;9318-25

  • Hyaluronan binding protein 1 (HABP1)/C1QBP/p32 is an endogenous substrate for MAP kinase and is translocated to the nucleus upon mitogenic stimulation.

    Majumdar M, Meenakshi J, Goswami SK and Datta K

    Biochemistry Laboratory, Jawaharlal Nehru University, New Delhi-110 067, India.

    The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro kinase assay demonstrated that it is a substrate for MAP kinase. Phosphorylation of endogenous HABP1 was also observed following treatment of J774 cells with PMA. HABP1 was coimmunoprecipitated with activated ERK, confirming their physical interaction in the cellular context. Upon PMA stimulation of normal rat fibroblast (F111) and transformed (HeLa) cells, the HABP1 level in the cytoplasm gradually decreased with a parallel increase in the nucleus. In HeLa cells, within 6 h of PMA treatment, HABP1 was completely translocated to the nucleus, which was prevented by PD98059, a selective inhibitor of ERK. We also observed that the nuclear translocation of HABP1 is concurrent with that of ERK, suggesting that ERK activation is a requirement for the translocation of HABP1. It is thus established for the first time that HABP1 is a substrate for ERK and an integral part of the MAP kinase cascade.

    Biochemical and biophysical research communications 2002;291;4;829-37

  • Surface expression of complement receptor gC1q-R/p33 is increased on the plasma membrane of human spermatozoa after capacitation.

    Grace KS, Bronson RA and Ghebrehiwet B

    Department of Medicine, State University of New York, Stony Brook, New York 11794-8161, USA.

    Evidence is increasing that complement components might play a role in fertilization. C1q, the first component of the classical complement cascade, has the ability to promote sperm agglutination in a capacitation-dependent manner as well as an effect on sperm-oolemma binding and fusion. We have previously detected gC1qR, the receptor for the globular head portion of C1q, on the surface of capacitated sperm. In this study, we examined the exp 1c1c ression of gC1qR in both fresh and capacitated human spermatozoa. We performed immunoprecipitation for gC1qR and analyzed biotinylated sperm membrane by Western blot to illustrate an increase in receptor density after overnight capacitation. These results were confirmed by flow cytometric analysis of spermatozoa using fluorescein isothiocyanate-labeled monoclonal anti-gC1qR antibody. Confocal, indirect immunofluorescence microscopy revealed an increase in receptor expression over the rostral portion of the sperm head after capacitation. In addition, the ability of live spermatozoa to bind to monoclonal anti-gC1qR antibody-coated microtiter wells was also increased after capacitation. These results suggest that gC1qR may play a role in human fertilization.

    Funded by: NIGMS NIH HHS: GM 08444

    Biology of reproduction 2002;66;3;823-9

  • M phase-specific association of human topoisomerase IIIbeta with chromosomes.

    Kobayashi M and Hanai R

    Department of Chemistry, College of Science, Rikkyo (St. Paul's) University, 3-34-1 Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501, Japan.

    Two isoforms, 1 and 2, of human DNA topoisomerase IIIbeta were expressed in HeLa cells as a fusion protein to the C-terminus of green fluorescent protein (GFP). The fusion protein of the isoform 1 was found to be localized to the nucleus, and to be associated with chromosomes during metaphase and anaphase. As yeast top3 mutants are known to exhibit phenotypes indicative of defective chromosome segregation, the result suggests that the isoform 1 of the human enzyme may also be involved in chromosome segregation. Two-hybrid screening for interaction partners of the isoform identified three candidate genes: CENP-F, a gene encoding a centromere protein and two genes of no known function, one of which was novel. The GFP fusion of the isoform 2 was found in the cytoplasm, indicating the nuclear localization signal sequence in the isoform 1 is in the C-terminal part that is different between the two isoforms.

    Biochemical and biophysical research communications 2001;287;1;282-7

  • Interaction between GABA(A) receptor beta subunits and the multifunctional protein gC1q-R.

    Schaerer MT, Kannenberg K, Hunziker P, Baumann SW and Sigel E

    Department of Pharmacology, University of Bern, CH-3010 Bern, Switzerland.

    gamma-Aminobutyric acid type A (GABA(A)) receptors were immunopurified from bovine brain using a monoclonal antibody directed against the alpha1 subunit. Of the several proteins that copurified, a 34-kDa protein was analyzed further. After enrichment and tryptic proteolysis, the resulting fragments were sequenced, and the protein was identified as gC1q-R. Using anti-gC1q-R and anti-GABA(A) receptor antibodies, mutual coimmunoprecipitation could be demonstrated from solubilized rat brain membranes. The stability of this interaction was estimated to be very high. Using the yeast two-hybrid system, various GABA(A) receptor subunit intracellular loop constructs were tested for an interaction with gC1q-R. All beta subunits, but not alpha 1 and gamma 2 subunits, were found to bind to gC1q-R. NH(2)- and COOH-terminally truncated beta 2 subunit loops were used to find the region responsible for the interaction with gC1q-R. A stretch of 15 amino acids containing 7 positively charged residues was identified (amino acids 399--413). This region contains residue Ser-410, which is a protein kinase substrate, and it is known that phosphorylation of this residue leads to an alteration in receptor activity. Localization studies suggested a predominantly intracellular localization. Our observations therefore suggest a tight interaction between gC1q-R and the GABA(A) receptor which might be involved in receptor biosynthesis or modulation of the mature function.

    The Journal of biological chemistry 2001;276;28;26597-604

  • The human gC1qR/p32 gene, C1qBP. Genomic organization and promoter analysis.

    Tye AJ, Ghebrehiwet B, Guo N, Sastry KN, Chow BK, Peerschke EI and Lim BL

    Department of Zoology, University of Hong Kong, Pokfulam, Hong Kong, China.

    gC1qR is an ubiquitously expressed cell protein that interacts with the globular heads of C1q (gC1q) and many other ligands. In this study, the 7.8-kilobase pair (kb) human gC1qR/p32 (C1qBP) gene was cloned and found to consist of 6 exons and 5 introns. Analysis of a 1.3-kb DNA fragment at the 5'-flanking region of this gene revealed the presence of multiple TATA, CCAAT, and Sp1 binding sites. Luciferase reporter assays performed in different human cell lines demonstrated that the reporter gene was ubiquitously driven by this 1.3-kb fragment. Subsequent 5' and 3' deletion of this fragment confined promoter elements to within 400 base pairs (bp) upstream of the translational start site. Because the removal of the 8-bp consensus TATATATA at -399 to -406 and CCAAT at -410 to -414 did not significantly affect the transcription efficiency of the promoter, GC-rich sequences between this TATA box and the translation start site may be very important for the promoter activity of the C1qBP gene. One of seven GC-rich sequences in this region binds specifically to PANC-1 nuclear extracts, and the transcription factor Sp1 was shown to bind to this GC-rich sequence by the supershift assay. Primer extension analysis mapped three major transcription start regions. The farthest transcription start site is 49 bp upstream of the ATG translation initiation codon and is in close proximity of the specific SP1 binding site.

    The Journal of biological chemistry 2001;276;20;17069-75

  • Expression and colocalization of cytokeratin 1 and urokinase plasminogen activator receptor on endothelial cells.

    Mahdi F, Shariat-Madar Z, Todd RF, Figueroa CD and Schmaier AH

    Hematology and Oncology Division, Department of Internal Medicine and Pathology, University of Michigan, Ann Arbor, MI 48109-0640, USA.

    The cellular localization of human cytokeratin 1 (CK1), urokinase plasminogen activator receptor (uPAR), and gC1qR, high-molecular-weight kininogen (HK)-binding proteins on endothelial cells, was determined. CK1 was found on the external membrane of nonpermeabilized endothelial cells by immunoperoxidase staining, immunofluorescence, and transmission electron microscopy using immunogold. Human umbilical vein endothelial cells (HUVECs) had 7.2 +/- 0.2 x 10(4) specific CK1 membrane sites/cell by (125)I-F(ab')(2) anti-CK1 antibody binding. Flow cytometry studies confirmed the presence of CK1, uPAR, and gC1qR on HUVECs. On laser scanning confocal microscopy and transmission electron microscopy, CK1 and uPAR, but not gC1qR, colocalized on the cell surface of HUVECs. The HUVEC surface distribution of these proteins was distinctly different from that for von Willebrand factor. In competitive inhibition experiments, anti-CK1, anti-uPAR, or anti-gC1qR blocked both biotin-HK binding and prekallikrein (PK) activation on HUVECs with an inhibitory concentration of 50% (IC(50)) of 300 to 350 nM, 50 to 60 nM, or 35 to 100 nM, respectively. Also, antibodies to uPAR and gC1qR each inhibited 86% of kallikrein-mediated, 2-chain urokinase plasminogen activation, whereas antibodies to CK1 only inhibited 24% of plasminogen activation. On HUVECs, CK1 and uPAR, but not gC1qR, colocalized to be a multiprotein receptor complex for HK binding, PK activation, and 2-chain urokinase plasminogen activation.

    Funded by: NCI NIH HHS: CA39064, CA42246; NHLBI NIH HHS: HL52779, HL56415

    Blood 2001;97;8;2342-50

  • Protein kinase C [micro] is regulated by the multifunctional chaperon protein p32.

    Storz P, Hausser A, Link G, Dedio J, Ghebrehiwet B, Pfizenmaier K and Johannes FJ

    Institute of Cell Biology and Immunology, University of Stuttgart, Allmandring 31, 70569 Stuttgart, Germany.

    We identified the multifunctional chaperon protein p32 as a protein kinase C (PKC)-binding protein interacting with PKCalpha, PKCzeta, PKCdelta, and PKC mu. We have analyzed the interaction of PKC mu with p32 in detail, and we show here in vivo association of PKC mu, as revealed from yeast two-hybrid analysis, precipitation assays using glutathione S-transferase fusion proteins, and reciprocal coimmunoprecipitation. In SKW 6.4 cells, PKC mu is constitutively associated with p32 at mitochondrial membranes, evident from colocalization with cytochrome c. p32 interacts with PKC mu in a compartment-specific manner, as it can be coimmunoprecipitated mainly from the particulate and not from the soluble fraction, despite the presence of p32 in both fractions. Although p32 binds to the kinase domain of PKC mu, it does not serve as a substrate. Interestingly, PKC mu-p32 immunocomplexes precipitated from the particulate fraction of two distinct cell lines, SKW 6.4 and 293T, show no detectable substrate phosphorylation. In support of a kinase regulatory function of p32, addition of p32 to in vitro kinase assays blocked, in a dose-dependent manner, aldolase but not autophosphorylation of PKC mu, suggesting a steric hindrance of substrate within the kinase domain. Together, these findings identify p32 as a novel, compartment-specific regulator of PKC mu kinase activity.

    The Journal of biological chemistry 2000;275;32;24601-7

  • Rubella virus capsid associates with host cell protein p32 and localizes to mitochondria.

    Beatch MD and Hobman TC

    Department of Cell Biology, University of Alberta, Edmonton, Alberta T6G 2H7, Canada.

    Togavirus nucleocapsids have a characteristic icosahedral structure and are composed of multiple copies of a capsid protein complexed with genomic RNA. The assembly of rubella virus nucleocapsids is unique among togaviruses in that the process occurs late in virus assembly and in association with intracellular membranes. The goal of this study was to identify host cell proteins which may be involved in regulating rubella virus nucleocapsid assembly through their interactions with the capsid protein. Capsid was used as bait to screen a CV1 cDNA library using the yeast two-hybrid system. One protein that interacted strongly with capsid was p32, a cellular protein which is known to interact with other viral proteins. The interaction between capsid and p32 was confirmed using a number of different in vitro and in vivo methods, and the site of interaction between these two proteins was shown to be at the mitochondria. Interestingly, overexpression of the rubella virus structural proteins resulted in clustering of the mitochondria in the perinuclear region. The p32-binding site in capsid is a potentially phosphorylated region that overlaps the viral RNA-binding domain of capsid. Our results are consistent with the possibility that the interaction of p32 with capsid plays a role in the regulation of nucleocapsid assembly and/or virus-host interactions.

    Journal of virology 2000;74;12;5569-76

  • gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes.

    Braun L, Ghebrehiwet B and Cossart P

    Unité des Interactions Bactéries-Cellules, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris cedex 15, France.

    InlB is a Listeria monocytogenes protein that promotes entry of the bacterium into mammalian cells by stimulating tyrosine phosphorylation of the adaptor proteins Gab1, Cbl and Shc, and activation of phosphatidyl- inositol (PI) 3-kinase. Using affinity chromatography and enzyme-linked immunosorbent assay, we demonstrate a direct interaction between InlB and the mammalian protein gC1q-R, the receptor of the globular part of the complement component C1q. Soluble C1q or anti-gC1q-R antibodies impair InlB-mediated entry. Transient transfection of GPC16 cells, which are non-permissive to InlB-mediated entry, with a plasmid-expressing human gC1q-R promotes entry of InlB-coated beads. Furthermore, several experiments indicate that membrane recruitment and activation of PI 3-kinase involve an InlB-gC1q-R interaction and that gC1q-R associates with Gab1 upon stimulation of Vero cells with InlB. Thus, gC1q-R constitutes a cellular receptor involved in InlB-mediated activation of PI 3-kinase and tyrosine phosphorylation of the adaptor protein Gab1. After E-cadherin, the receptor for internalin, gC1q-R is the second identified mammalian receptor promoting entry of L. monocytogenes into mammalian cells.

    The EMBO journal 2000;19;7;1458-66

  • Crystal structure of human p32, a doughnut-shaped acidic mitochondrial matrix protein.

    Jiang J, Zhang Y, Krainer AR and Xu RM

    W. M. Keck Structural Biology Laboratory, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA.

    Human p32 (also known as SF2-associated p32, p32/TAP, and gC1qR) is a conserved eukaryotic protein that localizes predominantly in the mitochondrial matrix. It is thought to be involved in mitochondrial oxidative phosphorylation and in nucleus-mitochondrion interactions. We report the crystal structure of p32 determined at 2.25 A resolution. The structure reveals that p32 adopts a novel fold with seven consecutive antiparallel beta-strands flanked by one N-terminal and two C-terminal alpha-helices. Three monomers form a doughnut-shaped quaternary structure with an unusually asymmetric charge distribution on the surface. The implications of the structure on previously proposed functions of p32 are discussed and new specific functional properties are suggested.

    Funded by: NCI NIH HHS: CA13106, P01 CA013106; NIGMS NIH HHS: GM55874, R01 GM055874

    Proceedings of the National Academy of Sciences of the United States of America 1999;96;7;3572-7

  • The splicing factor-associated protein, p32, regulates RNA splicing by inhibiting ASF/SF2 RNA binding and phosphorylation.

    Petersen-Mahrt SK, Estmer C, Ohrmalm C, Matthews DA, Russell WC and Akusjärvi G

    Department of Medical Biochemistry and Microbiology, BMC, Uppsala University, S-751 23 Uppsala, Sweden.

    The cellular protein p32 was isolated originally as a protein tightly associated with the essential splicing factor ASF/SF2 during its purification from HeLa cells. ASF/SF2 is a member of the SR family of splicing factors, which stimulate constitutive splicing and regulate alternative RNA splicing in a positive or negative fashion, depending on where on the pre-mRNA they bind. Here we present evidence that p32 interacts with ASF/SF2 and SRp30c, another member of the SR protein family. We further show that p32 inhibits ASF/SF2 function as both a splicing enhancer and splicing repressor protein by preventing stable ASF/SF2 interaction with RNA, but p32 does not block SRp30c function. ASF/SF2 is highly phosphorylated in vivo, a modification required for stable RNA binding and protein-protein interaction during spliceosome formation, and this phosphorylation, either through HeLa nuclear extracts or through specific SR protein kinases, is inhibited by p32. Our results suggest that p32 functions as an ASF/SF2 inhibitory factor, regulating ASF/SF2 RNA binding and phosphorylation. These findings place p32 into a new group of proteins that control RNA splicing by sequestering an essential RNA splicing factor into an inhibitory complex.

    The EMBO journal 1999;18;4;1014-24

  • Assignment of cDNA encoding hyaluronic acid-binding protein 1 to human chromosome 17p12-p13.

    Majumdar M and Datta K

    School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, 110067, India.

    Genomics 1998;51;3;476-7

  • Assignment of C1QBP encoding the C1q globular domain binding protein (gC1q-R) to human chromosome 17 band p13.3 by in situ hybridization.

    Guo N, Weremowicz S, Lynch N, Lim BL, Schwaeble W, Peerschke EI, Morton CC, Reid KB, Ghebrehiwet B and Sastry KN

    Department of Pathology and Laboratory Medicine, Boston University School of Medicine, MA 02118-2393, USA.

    Funded by: NHLBI NIH HHS: R01 HL5029101; NIAID NIH HHS: AI33130; NIDCD NIH HHS: R01 DC003402; Wellcome Trust

    Cytogenetics and cell genetics 1997;77;3-4;283-4

  • In vitro interaction between human immunodeficiency virus type 1 Rev protein and splicing factor ASF/SF2-associated protein, p32.

    Tange TO, Jensen TH and Kjems J

    Department of Molecular Biology, University of Aarhus, C. F. Møllers Allé, Building 130, DK-8000 Aarhus C, Denmark.

    Continuous replication of human immunodeficiency virus type 1 requires the expression of the regulatory protein Rev, which binds to the Rev response element (RRE) and up-regulates the cytoplasmic appearance of singly spliced and unspliced mRNA species. It has been demonstrated that the murine protein YL2 interacts with Rev in vivo and modulates the activity of Rev (Luo, Y., Yu, H., and Peterlin, B. M. (1994) J. Virol. 68, 3850-3856). Here we show that the YL2 human homologue, the p32 protein, which co-purifies with alternative splicing factor ASF/SF2, interacts directly with the basic domain of Rev in vitro and that the Rev-p32 complex is resistant to high concentrations of salt or nonionic detergent. Protein footprinting data suggest that Rev interacts specifically with amino acids within the 196-208 region of p32. An analysis of the ternary complex, formed among p32, Rev, and RRE RNA, shows that Rev can bridge the association of p32 and RRE. Furthermore, we demonstrate that exogenously added p32 specifically relieves the inhibition of splicing in vitro exerted by the basic domain of Rev. Our data are consistent with a model in which p32 functions as a link between Rev and the cellular splicing apparatus.

    The Journal of biological chemistry 1996;271;17;10066-72

  • Molecular cloning of human fibroblast hyaluronic acid-binding protein confirms its identity with P-32, a protein co-purified with splicing factor SF2. Hyaluronic acid-binding protein as P-32 protein, co-purified with splicing factor SF2.

    Deb TB and Datta K

    Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, India.

    The purification of a 68-kDa hyaluronic acid-binding protein (HA-binding protein), a homodimer of 34 kDa that binds specifically to hyaluronic acid, has been reported earlier by us (Gupta, S., Batchu, R.B., and Datta, K. (1991) Eur. J. Cell Biol. 56, 58-67). Here, we report the isolation of a partial cDNA clone from a lambda gt11 cDNA expression library of human skin fibroblast by immuno-screening with HA-binding protein antiserum. The internal polypeptide sequence (83 residues) of the purified hyaluronic acid-binding protein is identical to the predicted protein sequence derived from hyaluronic acid-binding protein cDNA, suggesting the authenticity of the clone. Interestingly, this hyaluronic acid-binding protein cDNA sequence has complete homology with the cDNA sequence of a protein P-32, co-purified with the human pre-mRNA splicing factor SF2 (Krainer, A.R., Mayeda, A., Kozak, D., and Binns, G. (1991) Cell 66, 383-394). Furthermore, the data on the N-terminal sequence of hyaluronic acid-binding protein and the predicted polypeptide of P-32 revealed the identical coding sequence of 209 amino acids for both the proteins. As the identity and functional characterization of P-32 have not yet been reported, P-32 cDNA was expressed in Escherichia coli, and the recombinant P-32 protein was purified by hyaluronic acid-Sepharose affinity chromatography. The recombinant P-32 protein showed immunocross-reactivity with the polyclonal antibodies raised against HA-binding protein. The predicted amino acid sequence of the protein fulfilled the minimal criteria for binding to hyaluronic acid, i.e. two basic amino acids flanking a seven-amino acid stretch, as reported for other hyaluronic acid affinity of the recombinant P-32 protein was confirmed by biotinylated hyaluronic acid binding assay. The binding of recombinant P-32 protein to biotinylated hyaluronic acid binding assay. The binding of recombinant P-32 protein to biotinylated hyaluronic acid can be competed only with excess unlabeled hyaluronic acid, confirming its specificity toward hyaluronic acid. All these results suggest that both P-32, co-purified with the human pre-mRNA splicing factor SF2, and 34-kDa hyaluronic acid-binding protein reported by us are the same protein and that it is a new member of the hyaluronic acid-binding protein family, the "hyaladherins."

    The Journal of biological chemistry 1996;271;4;2206-12

  • Identification of a novel human zinc finger protein that specifically interacts with the activation domain of lentiviral Tat proteins.

    Fridell RA, Harding LS, Bogerd HP and Cullen BR

    Howard Hughes Medical Institute, Durham, North Carolina, USA.

    Transcriptional activation of HIV-1 gene expression by the viral Tat protein requires the interaction of a cellular cofactor with the Tat activation domain. This domain has been shown to consist of the cysteine-rich and core motifs of HIV-1 Tat and is functionally conserved in the distantly related Tat proteins of HIV-2 and EIAV. Using the yeast two-hybrid system, we have identified a novel human gene product, termed HT2A, that specifically and precisely binds to the activation domain of HIV-1 Tat and that can also interact with the HIV-2 and EIAV Tat proteins in vivo. We present data further demonstrating that the interaction between the activation domain of HIV-1 Tat and the HT2A protein can be readily detected in the mammalian cell nucleus. Sequence analysis demonstrates that HT2A is a novel member of the C3HC4 or ring finger family of zinc finger proteins that includes several known oncogenes and transcription factors. Overall, these data suggest that HT2A may play a significant role in mediating the biological activity of the HIV-1 Tat protein in vivo.

    Virology 1995;209;2;347-57

  • Isolation, cDNA cloning, and overexpression of a 33-kD cell surface glycoprotein that binds to the globular "heads" of C1q.

    Ghebrehiwet B, Lim BL, Peerschke EI, Willis AC and Reid KB

    Department of Medicine, State University of New York, Stony Brook 11794-8161.

    This work describes the functional characterization, cDNA cloning, and expression of a novel cell surface protein. This protein designated gC1q-R, was first isolated from Raji cells and was found to bind to the globular "heads" of C1q molecules, at physiological ionic strength, and also to inhibit complement-mediated lysis of sheep erythrocytes by human serum. The NH2-terminal amino acid sequence of the first 24 residues of the C1q-binding protein was determined and this information allowed the synthesis of two degenerate polymerase chain reaction primers for use in the preparation of a probe in the screening of a B cell cDNA library. The cDNA isolated, using this probe, was found to encode a pre-pro protein of 282 residues. The NH2 terminus of the protein isolated from Raji cells started at residue 74 of the predicted pre-pro sequence. The cDNA sequence shows that the purified protein has three potential N-glycosylation residues and is a highly charged, acidic molecule. Hence, its binding to C1q may be primarily but not exclusively due to ionic interactions. The "mature" protein, corresponding to amino acid residues 74-282 of the predicted pre-pro sequence, was overexpressed in Escherichia coli and was purified to homogeneity. This recombinant protein was also able to inhibit the complement-mediated lysis of sheep erythrocytes by human serum and was shown to be a tetramer by gel filtration in nondissociating conditions. Northern blot and RT-PCR studies showed that the C1q-binding protein is expressed at high levels in Raji and Daudi cell lines, at moderate levels in U937, Molt-4, and HepG2 cell lines, and at a very low level in the HL60 cell line. However, it is not expressed in the K562 cell line. Comparison of gC1q-R NH2-terminal sequence with that of the receptor for the collagen-like domain of C1q (cC1q-R) showed no similarity. Furthermore, antibodies to gC1q-R or an 18-amino acid residue-long NH2-terminal synthetic gC1q-R peptide did not cross-react with antibodies to cC1q-R. Anti-gC1q-R immunoblotted a 33-kD Raji cell membrane protein, whereas anti cC1q-R recognized a molecule of approximately 60 kD. The NH2-terminal sequence of gC1g-R appears to be displayed extracellularly since anti-gC1g-R peptide reacted with surface molecules on lymphocytes, polymorphonuclear leukocytes, and platelets, as assessed by flow cytometric and confocal laser scanning microscopic analyses.(ABSTRACT TRUNCATED AT 400 WORDS)

    Funded by: FIC NIH HHS: FO6-TW01732; NCI NIH HHS: CA-41047; NHLBI NIH HHS: HL28183

    The Journal of experimental medicine 1994;179;6;1809-21

  • Cellular protein modulates effects of human immunodeficiency virus type 1 Rev.

    Luo Y, Yu H and Peterlin BM

    Howard Hughes Medical Institute, San Francisco, California.

    Replication of human immunodeficiency virus type 1 requires expression of the viral trans activator Rev. Rev binds to a highly structured RNA, the Rev response element, which is present in singly spliced and unspliced genomic viral RNAs. Although Rev helps to transport these transcripts from the nucleus to the cytoplasm, the mechanism(s) involved is not fully understood. Using the yeast two-hybrid system, we isolated a murine protein (YL2) that interacts with the basic domain of Rev, which is essential for the function of Rev in vivo and for the inhibitory splicing activity of Rev in vitro. YL2 has 92% identity to a human 32-kDa protein (p32), which copurifies with alternative splicing factor SF2/ASF. Furthermore, we found that whereas expression of YL2 greatly potentiated the activity of Rev, antisense YL2 transcripts blocked the effects of Rev in mammalian cells. YL2 also increased the activities of Rex on the Rex response element and of hybrid Rev proteins fused to Tat and the coat protein of bacteriophage MS2 on their respective RNAs. Thus, YL2 or p32 is a cellular protein that modulates the function of human immunodeficiency virus type 1 Rev.

    Journal of virology 1994;68;6;3850-6

  • Cloning and expression of a cDNA covering the complete coding region of the P32 subunit of human pre-mRNA splicing factor SF2.

    Honoré B, Madsen P, Rasmussen HH, Vandekerckhove J, Celis JE and Leffers H

    Institute of Medical Biochemistry, Danish Centre for Human Genome Research, Aarhus University.

    We have cloned and expressed a cDNA encoding the 32-kDa subunit (P32) of the human pre-mRNA splicing factor, SF2. This cDNA extends beyond the 5'-end of a previously reported cDNA [Krainer et al., Cell 66 (1991) 383-394]. Importantly, our fragment includes an ATG start codon which was absent from the previously reported cDNA, where it was suggested that translation might initiate at a CTG codon instead of at an ATG codon. Using the vaccinia virus (Vv) expression system, we demonstrate that translation starts at the conventional ATG start codon and not at the CTG codon. The protein is synthesized as a pro-protein of 282 amino acids (aa) that is post-translationally processed by removal of the initial 73 aa to a mature protein of 209 aa.

    Gene 1993;134;2;283-7

  • Functional expression of cloned human splicing factor SF2: homology to RNA-binding proteins, U1 70K, and Drosophila splicing regulators.

    Krainer AR, Mayeda A, Kozak D and Binns G

    Cold Spring Harbor Laboratory, New York 11724-2208.

    SF2 is a protein factor essential for constitutive pre-mRNA splicing in HeLa cell extracts and also activates proximal alternative 5' splice sites in a concentration-dependent manner. This latter property suggests a role for SF2 in preventing exon skipping, ensuring the accuracy of splicing, and regulating alternative splicing. Human SF2 cDNAs have been isolated and overexpressed in bacteria. Recombinant SF2 is active in splicing and stimulates proximal 5' splice sites. SF2 has a C-terminal region rich in arginine-serine dipeptides, similar to the RS domains of the U1 snRNP 70K polypeptide and the Drosophila alternative splicing regulators transformer, transformer-2, and suppressor-of-white-apricot. Like transformer-2 and 70K, SF2 contains an RNP-type RNA recognition motif.

    Funded by: NCI NIH HHS: CA13106; NIGMS NIH HHS: GM42699

    Cell 1991;66;2;383-94

  • NH2-terminal calcium-binding domain of human complement C1s- mediates the interaction of C1r- with C1q.

    Busby TF and Ingham KC

    Biochemistry Laboratory, American Red Cross Biomedical Research and Development, Rockville, Maryland 20855.

    The assembly of C1, the first component of human complement, involves interactions between various domains of each of its three subcomponents, C1q, C1r, and C1s. The isolation, assignment of function, and structural characterization of the individual domains of C1r and C1s are critical for a thorough understanding of this complex assembly. The present study describes a 27-kDa plasmin-generated fragment derived from the NH2-terminal half of the heavy A chain of C1s-, the activated form of C1s. This fragment, C1s-alpha, was shown in the presence of Ca2+ to mimic the ability of whole C1s- to self-associate, bind to C1r-, and facilitate the binding of C1r to C1q. These results directly prove that the Ca2(+)-binding sites of C1s as well as all of the determinants necessary for binding of C1s- to C1r- and C1q are located in the NH2-terminal 27-kDa alpha region of the A chain.

    Funded by: NHLBI NIH HHS: HL21791

    Biochemistry 1990;29;19;4613-8

Gene lists (6)

Gene List Source Species Name Description Gene count
L00000009 G2C Homo sapiens Human PSD Human orthologues of mouse PSD adapted from Collins et al (2006) 1080
L00000010 G2C Homo sapiens Human mitochondria Human orthologues of mouse mitochondria adapted from Collins et al (2006) 91
L00000011 G2C Homo sapiens Human clathrin Human orthologues of mouse clathrin coated vesicle genes adapted from Collins et al (2006) 150
L00000012 G2C Homo sapiens Human Synaptosome Human orthologues of mouse synaptosome adapted from Collins et al (2006) 152
L00000016 G2C Homo sapiens Human PSP Human orthologues of mouse PSP adapted from Collins et al (2006) 1121
L00000069 G2C Homo sapiens BAYES-COLLINS-HUMAN-PSD-FULL Human cortex biopsy PSD full list 1461
© G2C 2014. The Genes to Cognition Programme received funding from The Wellcome Trust and the EU FP7 Framework Programmes:
EUROSPIN (FP7-HEALTH-241498), SynSys (FP7-HEALTH-242167) and GENCODYS (FP7-HEALTH-241995).

Cookies Policy | Terms and Conditions. This site is hosted by Edinburgh University and the Genes to Cognition Programme.